Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125033475:

Variant ID: vg1125033475 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25033475
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, A: 0.11, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ACCAAGTGGGTTTTTGTCACACCCCGAAGTTCTTTCCCAAGCCTAAATTCAAGTTATAAATGGTCTCAAGAAAATACTAGTGTAAAGCAAGAGTAAACCT[T/A]
AATAAATTAATGCAAATAATAATCGGAATTGGCATGTGGAATTTTTCTTGAGTTCTACATGTCGAAATTCGCTAACAAGATTTTTAGTGGAATTTTCAGA

Reverse complement sequence

TCTGAAAATTCCACTAAAAATCTTGTTAGCGAATTTCGACATGTAGAACTCAAGAAAAATTCCACATGCCAATTCCGATTATTATTTGCATTAATTTATT[A/T]
AGGTTTACTCTTGCTTTACACTAGTATTTTCTTGAGACCATTTATAACTTGAATTTAGGCTTGGGAAAGAACTTCGGGGTGTGACAAAAACCCACTTGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.20%	46.00%	0.11%	3.66%	NA
All Indica	2759	70.10%	26.20%	0.14%	3.52%	NA
All Japonica	1512	12.10%	87.70%	0.00%	0.20%	NA
Aus	269	69.50%	13.00%	0.37%	17.10%	NA
Indica I	595	67.70%	32.30%	0.00%	0.00%	NA
Indica II	465	67.50%	23.40%	0.00%	9.03%	NA
Indica III	913	76.90%	22.80%	0.11%	0.22%	NA
Indica Intermediate	786	65.60%	27.20%	0.38%	6.74%	NA
Temperate Japonica	767	7.00%	92.70%	0.00%	0.26%	NA
Tropical Japonica	504	11.30%	88.70%	0.00%	0.00%	NA
Japonica Intermediate	241	29.90%	69.70%	0.00%	0.41%	NA
VI/Aromatic	96	28.10%	50.00%	0.00%	21.88%	NA
Intermediate	90	44.40%	48.90%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125033475	T -> A	LOC_Os11g41690.1	downstream_gene_variant ; 140.0bp to feature; MODIFIER	silent_mutation	Average:23.697; most accessible tissue: Zhenshan97 flag leaf, score: 33.231	N	N	N	N
vg1125033475	T -> A	LOC_Os11g41700.1	downstream_gene_variant ; 2206.0bp to feature; MODIFIER	silent_mutation	Average:23.697; most accessible tissue: Zhenshan97 flag leaf, score: 33.231	N	N	N	N
vg1125033475	T -> A	LOC_Os11g41690-LOC_Os11g41700	intergenic_region ; MODIFIER	silent_mutation	Average:23.697; most accessible tissue: Zhenshan97 flag leaf, score: 33.231	N	N	N	N
vg1125033475	T -> DEL	N	N	silent_mutation	Average:23.697; most accessible tissue: Zhenshan97 flag leaf, score: 33.231	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125033475	NA	2.18E-06	mr1531_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125033475	NA	9.54E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125033475	7.86E-07	NA	mr1807_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251