Variant ID: vg1124992937 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 24992937 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 254. )
GCTCGTGCCGGCAAAATCAAAGGTAAAAGTAAACATATTGCAATTTTCTGATTATTACTTGCAATGCTTACTGAGGAAATTACATGCATGCAGGCTTTAC[G/A]
GGAATAGATGATCCTTATGAAACACCTTCAGATTGTGAGGTTAGCCAAATATCTTTCATATTCATACTAACATCAGCTTCTCAATAAAATAAAAACATCA
TGATGTTTTTATTTTATTGAGAAGCTGATGTTAGTATGAATATGAAAGATATTTGGCTAACCTCACAATCTGAAGGTGTTTCATAAGGATCATCTATTCC[C/T]
GTAAAGCCTGCATGCATGTAATTTCCTCAGTAAGCATTGCAAGTAATAATCAGAAAATTGCAATATGTTTACTTTTACCTTTGATTTTGCCGGCACGAGC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
All Indica | 2759 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Aus | 269 | 82.50% | 17.50% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1124992937 | G -> A | LOC_Os11g41650.2 | synonymous_variant ; p.Thr259Thr; LOW | synonymous_codon | Average:42.498; most accessible tissue: Callus, score: 74.755 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1124992937 | 3.06E-07 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124992937 | 3.44E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124992937 | 5.18E-07 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124992937 | 2.00E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124992937 | 4.94E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124992937 | 4.27E-06 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124992937 | 3.08E-09 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1124992937 | 4.75E-07 | NA | mr1900_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |