Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124952413:

Variant ID: vg1124952413 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24952413
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.09, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ACATCTCAAGAACAATTCATTGCAAAAGAGAGAGGTAAGCAAACCAAGAACTCTAAACAAACAAACAGAGATCTGCAATTCTGCATGCATACTCTGAACT[C/A]
CGAAACATGCATGGATATCAGACACCTGCCATGAAAGAAACAACTCAACAAGGTAAAGAAGATCACAAAACCCCAATCCTCACCTCTAATTAGGATTCCA

Reverse complement sequence

TGGAATCCTAATTAGAGGTGAGGATTGGGGTTTTGTGATCTTCTTTACCTTGTTGAGTTGTTTCTTTCATGGCAGGTGTCTGATATCCATGCATGTTTCG[G/T]
AGTTCAGAGTATGCATGCAGAATTGCAGATCTCTGTTTGTTTGTTTAGAGTTCTTGGTTTGCTTACCTCTCTCTTTTGCAATGAATTGTTCTTGAGATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 19.50% 0.11% 0.00% NA
All Indica  2759 94.80% 5.10% 0.07% 0.00% NA
All Japonica  1512 55.90% 43.90% 0.20% 0.00% NA
Aus  269 72.50% 27.50% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 88.80% 11.20% 0.00% 0.00% NA
Indica III  913 97.20% 2.60% 0.22% 0.00% NA
Indica Intermediate  786 91.90% 8.10% 0.00% 0.00% NA
Temperate Japonica  767 42.10% 57.50% 0.39% 0.00% NA
Tropical Japonica  504 76.60% 23.40% 0.00% 0.00% NA
Japonica Intermediate  241 56.40% 43.60% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124952413 C -> A LOC_Os11g41590.1 downstream_gene_variant ; 2739.0bp to feature; MODIFIER silent_mutation Average:82.234; most accessible tissue: Minghui63 young leaf, score: 94.299 N N N N
vg1124952413 C -> A LOC_Os11g41600.1 intron_variant ; MODIFIER silent_mutation Average:82.234; most accessible tissue: Minghui63 young leaf, score: 94.299 N N N N
vg1124952413 C -> A LOC_Os11g41600.2 intron_variant ; MODIFIER silent_mutation Average:82.234; most accessible tissue: Minghui63 young leaf, score: 94.299 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1124952413 C A 0.01 0.02 0.02 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124952413 1.01E-17 5.62E-18 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 8.31E-07 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 1.80E-14 1.55E-15 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 NA 4.76E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 2.56E-08 9.06E-08 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 4.15E-11 7.75E-12 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 5.82E-09 5.82E-09 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 2.47E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 2.76E-13 2.52E-13 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 1.67E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 2.39E-13 1.09E-13 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 4.43E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 6.29E-17 6.66E-17 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 4.91E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 7.41E-12 9.93E-12 mr1900_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124952413 5.62E-10 5.62E-10 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251