Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124898439:

Variant ID: vg1124898439 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24898439
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGTTAAGGGACCTCAGATGAACTTATTCCTCCCCGCTATAACCTTCAGGATGAAGCACACCAACAGCCTCCCCATCCACTAAAGTTCAAACAGTAACA[G/A]
TGCTCAAACAGTAATCCAATTTACTGTTGGATGCTTTTTACTGTAGCGTGATACTGTAGCAGGCTGATCTGTGCCGTTCGATAGAGATCCAATGGCTCAA

Reverse complement sequence

TTGAGCCATTGGATCTCTATCGAACGGCACAGATCAGCCTGCTACAGTATCACGCTACAGTAAAAAGCATCCAACAGTAAATTGGATTACTGTTTGAGCA[C/T]
TGTTACTGTTTGAACTTTAGTGGATGGGGAGGCTGTTGGTGTGCTTCATCCTGAAGGTTATAGCGGGGAGGAATAAGTTCATCTGAGGTCCCTTAACTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.10%	15.20%	0.34%	0.38%	NA
All Indica	2759	97.70%	2.20%	0.04%	0.00%	NA
All Japonica	1512	63.50%	34.50%	0.86%	1.19%	NA
Aus	269	76.20%	23.40%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.50%	1.30%	0.22%	0.00%	NA
Indica III	913	96.40%	3.60%	0.00%	0.00%	NA
Indica Intermediate	786	97.20%	2.80%	0.00%	0.00%	NA
Temperate Japonica	767	87.40%	11.60%	0.52%	0.52%	NA
Tropical Japonica	504	36.10%	59.70%	1.59%	2.58%	NA
Japonica Intermediate	241	44.80%	54.40%	0.41%	0.41%	NA
VI/Aromatic	96	40.60%	59.40%	0.00%	0.00%	NA
Intermediate	90	84.40%	14.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124898439	G -> A	LOC_Os11g41500.1	upstream_gene_variant ; 4941.0bp to feature; MODIFIER	silent_mutation	Average:87.545; most accessible tissue: Minghui63 panicle, score: 98.639	N	N	N	N
vg1124898439	G -> A	LOC_Os11g41520.1	upstream_gene_variant ; 1528.0bp to feature; MODIFIER	silent_mutation	Average:87.545; most accessible tissue: Minghui63 panicle, score: 98.639	N	N	N	N
vg1124898439	G -> A	LOC_Os11g41510.1	downstream_gene_variant ; 162.0bp to feature; MODIFIER	silent_mutation	Average:87.545; most accessible tissue: Minghui63 panicle, score: 98.639	N	N	N	N
vg1124898439	G -> A	LOC_Os11g41500-LOC_Os11g41510	intergenic_region ; MODIFIER	silent_mutation	Average:87.545; most accessible tissue: Minghui63 panicle, score: 98.639	N	N	N	N
vg1124898439	G -> DEL	N	N	silent_mutation	Average:87.545; most accessible tissue: Minghui63 panicle, score: 98.639	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1124898439	G	A	-0.12	-0.13	-0.1	-0.14	-0.12	-0.11

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124898439	NA	1.22E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	NA	2.18E-12	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	NA	3.45E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	2.63E-06	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	NA	1.72E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	NA	2.44E-11	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	NA	7.14E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	NA	4.52E-07	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	2.97E-07	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	4.79E-06	4.79E-06	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	NA	2.61E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	2.92E-06	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	9.60E-08	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	1.98E-06	9.95E-07	mr1925_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	NA	1.94E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124898439	NA	2.96E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251