Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124867021:

Variant ID: vg1124867021 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24867021
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCTCTAGGACAAATGAAGGCTACACGAGCTGCGGCCCGGTAGTCGAGATGTCATGGCACAGAGCTGGTGTCCTGCTGCTAGGGGCTCGGTCCTGCCTAC[T/C]
TGTCCCGGAGGTTCCGGCCGTAGGCGGGGCTGGGTCGGTACTCTTGTTTATGGCTAGGATGGGTTGCGAACTATGTCACGTCTTCCGTCCGTATGCCGTG

Reverse complement sequence

CACGGCATACGGACGGAAGACGTGACATAGTTCGCAACCCATCCTAGCCATAAACAAGAGTACCGACCCAGCCCCGCCTACGGCCGGAACCTCCGGGACA[A/G]
GTAGGCAGGACCGAGCCCCTAGCAGCAGGACACCAGCTCTGTGCCATGACATCTCGACTACCGGGCCGCAGCTCGTGTAGCCTTCATTTGTCCTAGAGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.50%	14.70%	0.44%	16.42%	NA
All Indica	2759	96.60%	0.90%	0.04%	2.46%	NA
All Japonica	1512	21.40%	43.10%	1.06%	34.46%	NA
Aus	269	53.90%	0.40%	0.74%	44.98%	NA
Indica I	595	99.50%	0.30%	0.00%	0.17%	NA
Indica II	465	97.20%	1.50%	0.00%	1.29%	NA
Indica III	913	95.50%	0.20%	0.00%	4.27%	NA
Indica Intermediate	786	95.40%	1.70%	0.13%	2.80%	NA
Temperate Japonica	767	9.10%	78.90%	0.39%	11.60%	NA
Tropical Japonica	504	33.90%	2.20%	0.99%	62.90%	NA
Japonica Intermediate	241	34.40%	14.50%	3.32%	47.72%	NA
VI/Aromatic	96	43.80%	1.00%	0.00%	55.21%	NA
Intermediate	90	65.60%	17.80%	2.22%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124867021	T -> DEL	N	N	silent_mutation	Average:33.911; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg1124867021	T -> C	LOC_Os11g41440.1	upstream_gene_variant ; 1668.0bp to feature; MODIFIER	silent_mutation	Average:33.911; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg1124867021	T -> C	LOC_Os11g41460.1	upstream_gene_variant ; 4118.0bp to feature; MODIFIER	silent_mutation	Average:33.911; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg1124867021	T -> C	LOC_Os11g41430.1	downstream_gene_variant ; 3714.0bp to feature; MODIFIER	silent_mutation	Average:33.911; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg1124867021	T -> C	LOC_Os11g41450.1	downstream_gene_variant ; 1600.0bp to feature; MODIFIER	silent_mutation	Average:33.911; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg1124867021	T -> C	LOC_Os11g41440-LOC_Os11g41450	intergenic_region ; MODIFIER	silent_mutation	Average:33.911; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124867021	NA	5.81E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	7.05E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	2.20E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	3.11E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	4.10E-09	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	5.94E-17	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	6.16E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	4.29E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	1.94E-06	1.94E-06	mr1609_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	4.27E-12	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	9.41E-17	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	1.26E-08	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	1.43E-11	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124867021	NA	1.05E-07	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251