Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124641235:

Variant ID: vg1124641235 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24641235
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTCTATAGCAAAGGTAAAGAAAAAGTGCCTTTTTTTTAACCGAGGCAGATATTCCAGCTTTTAGATTTAGAAGAAGAGAATTGATCCAGTTTATAAG[A/G]
AAAACAGTGCCTGAAAACCATACAACTGCACGGTTAATTACAGGAAAACCGTCGGCTGAAACCCACTGCTACACAACTAACAACGACGGCAGAGCCCAAA

Reverse complement sequence

TTTGGGCTCTGCCGTCGTTGTTAGTTGTGTAGCAGTGGGTTTCAGCCGACGGTTTTCCTGTAATTAACCGTGCAGTTGTATGGTTTTCAGGCACTGTTTT[T/C]
CTTATAAACTGGATCAATTCTCTTCTTCTAAATCTAAAAGCTGGAATATCTGCCTCGGTTAAAAAAAAGGCACTTTTTCTTTACCTTTGCTATAGAACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 7.00% 0.00% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 80.40% 19.60% 0.00% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 91.90% 8.10% 0.00% 0.00% NA
Tropical Japonica  504 66.10% 33.90% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124641235 A -> G LOC_Os11g41130.2 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:75.981; most accessible tissue: Zhenshan97 flower, score: 94.053 N N N N
vg1124641235 A -> G LOC_Os11g41110-LOC_Os11g41130 intergenic_region ; MODIFIER silent_mutation Average:75.981; most accessible tissue: Zhenshan97 flower, score: 94.053 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1124641235 A G 0.04 0.03 0.02 0.01 0.05 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124641235 7.79E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124641235 8.96E-09 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124641235 NA 1.60E-06 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124641235 1.87E-07 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124641235 9.11E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124641235 7.93E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124641235 2.97E-07 8.66E-07 mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124641235 8.82E-08 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251