Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124453926:

Variant ID: vg1124453926 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24453926
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.34, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GTCATGTGGTCTCTTAGGAGGCCCACCTAAAAAAATAAACTTATTTTTGTAGGCGGATCTATTAAGGGGCCACATGAGAAAATGTATTTTTCTTACGACC[C/T,A]
GTGAAACTTCCTTCGAATATAATTTTTGCAGGCACGACCTGTTACAACCTGCCTATAACCTTCGTATAGAAAAATCGTTTCTGTAGTAGTGTATACTGCG

Reverse complement sequence

CGCAGTATACACTACTACAGAAACGATTTTTCTATACGAAGGTTATAGGCAGGTTGTAACAGGTCGTGCCTGCAAAAATTATATTCGAAGGAAGTTTCAC[G/A,T]
GGTCGTAAGAAAAATACATTTTCTCATGTGGCCCCTTAATAGATCCGCCTACAAAAATAAGTTTATTTTTTTAGGTGGGCCTCCTAAGAGACCACATGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.50%	13.10%	0.08%	0.00%	A: 2.29%
All Indica	2759	95.40%	4.50%	0.00%	0.00%	A: 0.07%
All Japonica	1512	69.70%	23.30%	0.00%	0.00%	A: 6.94%
Aus	269	73.20%	26.00%	0.37%	0.00%	A: 0.37%
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	88.20%	11.80%	0.00%	0.00%	NA
Indica III	913	97.80%	2.20%	0.00%	0.00%	NA
Indica Intermediate	786	93.40%	6.40%	0.00%	0.00%	A: 0.25%
Temperate Japonica	767	90.50%	8.30%	0.00%	0.00%	A: 1.17%
Tropical Japonica	504	38.10%	47.20%	0.00%	0.00%	A: 14.68%
Japonica Intermediate	241	69.70%	21.20%	0.00%	0.00%	A: 9.13%
VI/Aromatic	96	40.60%	57.30%	2.08%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124453926	C -> T	LOC_Os11g40870.1	downstream_gene_variant ; 1991.0bp to feature; MODIFIER	silent_mutation	Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529	N	N	N	N
vg1124453926	C -> T	LOC_Os11g40870-LOC_Os11g40890	intergenic_region ; MODIFIER	silent_mutation	Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529	N	N	N	N
vg1124453926	C -> A	LOC_Os11g40870.1	downstream_gene_variant ; 1991.0bp to feature; MODIFIER	silent_mutation	Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529	N	N	N	N
vg1124453926	C -> A	LOC_Os11g40870-LOC_Os11g40890	intergenic_region ; MODIFIER	silent_mutation	Average:63.754; most accessible tissue: Zhenshan97 flag leaf, score: 82.529	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124453926	5.57E-09	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	6.42E-08	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	9.93E-07	NA	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	4.73E-08	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	5.93E-12	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	1.28E-12	NA	mr1484_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	2.21E-09	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	1.34E-12	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	5.92E-12	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	4.51E-06	NA	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	4.97E-11	NA	mr1945_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124453926	NA	6.39E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251