Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124223852:

Variant ID: vg1124223852 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24223852
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, G: 0.22, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AATTCATCTAGCAACCACACCAAACAAGATTAACCCCTGACAAGGAGAAAAAAAAAAACAAGAATCTCTCCTAATGTTCTTGAAATCCCAAGAAGAAGAT[A/G]
TGGTGTTCATCCACCGTACCTGTGGATGGCCCTCTCGAGCAGCGGCCCCTCGTAGAGCCACCGGCGGCGGTCCACCGCCGCGAGGAACTCCAGCTGCCGG

Reverse complement sequence

CCGGCAGCTGGAGTTCCTCGCGGCGGTGGACCGCCGCCGGTGGCTCTACGAGGGGCCGCTGCTCGAGAGGGCCATCCACAGGTACGGTGGATGAACACCA[T/C]
ATCTTCTTCTTGGGATTTCAAGAACATTAGGAGAGATTCTTGTTTTTTTTTTTCTCCTTGTCAGGGGTTAATCTTGTTTGGTGTGGTTGCTAGATGAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.80% 0.08% 0.00% NA
All Indica  2759 84.30% 15.60% 0.07% 0.00% NA
All Japonica  1512 36.20% 63.80% 0.07% 0.00% NA
Aus  269 16.00% 84.00% 0.00% 0.00% NA
Indica I  595 89.60% 10.40% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 76.90% 23.00% 0.11% 0.00% NA
Indica Intermediate  786 83.60% 16.30% 0.13% 0.00% NA
Temperate Japonica  767 28.70% 71.20% 0.13% 0.00% NA
Tropical Japonica  504 40.50% 59.50% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 49.00% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124223852 A -> G LOC_Os11g40600.1 downstream_gene_variant ; 2394.0bp to feature; MODIFIER silent_mutation Average:84.008; most accessible tissue: Zhenshan97 young leaf, score: 92.356 N N N N
vg1124223852 A -> G LOC_Os11g40590.1 intron_variant ; MODIFIER silent_mutation Average:84.008; most accessible tissue: Zhenshan97 young leaf, score: 92.356 N N N N
vg1124223852 A -> G LOC_Os11g40590.2 intron_variant ; MODIFIER silent_mutation Average:84.008; most accessible tissue: Zhenshan97 young leaf, score: 92.356 N N N N
vg1124223852 A -> G LOC_Os11g40590.3 intron_variant ; MODIFIER silent_mutation Average:84.008; most accessible tissue: Zhenshan97 young leaf, score: 92.356 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1124223852 A G 0.02 0.06 0.06 -0.02 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124223852 NA 3.74E-08 mr1238 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124223852 NA 8.44E-06 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124223852 NA 2.29E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124223852 NA 2.70E-06 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124223852 NA 3.51E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124223852 NA 2.12E-06 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124223852 8.12E-06 8.12E-06 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124223852 NA 2.44E-06 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124223852 NA 1.14E-06 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251