Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124179798:

Variant ID: vg1124179798 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24179798
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, C: 0.11, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

GAAATTTAATTTTGAAGTTGATTTGGATAATTTTTTTTCACCTATTATTTTTTAGCATTGACTTTTAAAGCATGAATAATAAATAGGAGTATATAAGACG[T/C]
TGTATTAAATTCTTTTTGACTTGGCTTGGTTTTACTACTTCTCATTAGCCTTATCTCCACGGGTCAGAACATTGATAGATCAAGGAAAACCTTGTCTGGA

Reverse complement sequence

TCCAGACAAGGTTTTCCTTGATCTATCAATGTTCTGACCCGTGGAGATAAGGCTAATGAGAAGTAGTAAAACCAAGCCAAGTCAAAAAGAATTTAATACA[A/G]
CGTCTTATATACTCCTATTTATTATTCATGCTTTAAAAGTCAATGCTAAAAAATAATAGGTGAAAAAAAATTATCCAAATCAACTTCAAAATTAAATTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	40.40%	0.06%	0.00%	NA
All Indica	2759	81.90%	18.10%	0.07%	0.00%	NA
All Japonica	1512	28.00%	72.00%	0.00%	0.00%	NA
Aus	269	25.30%	74.70%	0.00%	0.00%	NA
Indica I	595	89.40%	10.40%	0.17%	0.00%	NA
Indica II	465	92.30%	7.50%	0.22%	0.00%	NA
Indica III	913	70.50%	29.50%	0.00%	0.00%	NA
Indica Intermediate	786	83.20%	16.80%	0.00%	0.00%	NA
Temperate Japonica	767	27.50%	72.50%	0.00%	0.00%	NA
Tropical Japonica	504	20.20%	79.80%	0.00%	0.00%	NA
Japonica Intermediate	241	46.10%	53.90%	0.00%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	52.20%	46.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124179798	T -> C	LOC_Os11g40510.1	upstream_gene_variant ; 4177.0bp to feature; MODIFIER	silent_mutation	Average:58.46; most accessible tissue: Callus, score: 90.021	N	N	N	N
vg1124179798	T -> C	LOC_Os11g40530.1	upstream_gene_variant ; 1107.0bp to feature; MODIFIER	silent_mutation	Average:58.46; most accessible tissue: Callus, score: 90.021	N	N	N	N
vg1124179798	T -> C	LOC_Os11g40540.1	upstream_gene_variant ; 4812.0bp to feature; MODIFIER	silent_mutation	Average:58.46; most accessible tissue: Callus, score: 90.021	N	N	N	N
vg1124179798	T -> C	LOC_Os11g40510.2	upstream_gene_variant ; 4177.0bp to feature; MODIFIER	silent_mutation	Average:58.46; most accessible tissue: Callus, score: 90.021	N	N	N	N
vg1124179798	T -> C	LOC_Os11g40540.2	upstream_gene_variant ; 4812.0bp to feature; MODIFIER	silent_mutation	Average:58.46; most accessible tissue: Callus, score: 90.021	N	N	N	N
vg1124179798	T -> C	LOC_Os11g40520.1	downstream_gene_variant ; 548.0bp to feature; MODIFIER	silent_mutation	Average:58.46; most accessible tissue: Callus, score: 90.021	N	N	N	N
vg1124179798	T -> C	LOC_Os11g40520-LOC_Os11g40530	intergenic_region ; MODIFIER	silent_mutation	Average:58.46; most accessible tissue: Callus, score: 90.021	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124179798	NA	5.68E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179798	NA	9.60E-09	mr1788	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179798	NA	8.41E-07	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124179798	NA	1.03E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251