Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124163322:

Variant ID: vg1124163322 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24163322
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CAACATGGGAACACGCCGCCGCCGACTCGTCCACATAGATGGACACCTCGCGTCCTCTGACAGATTAATCTGTAAGACGCTTCTTCGACGACATCGACCG[T/C]
GTCCTCTATGACGGCAACGACCGCATCACCGACGATGACATCGATCACGTCATCTACGACGACCAACCAAAGTGGTGGCCTCATTGCCAACGACGTCCCC

Reverse complement sequence

GGGGACGTCGTTGGCAATGAGGCCACCACTTTGGTTGGTCGTCGTAGATGACGTGATCGATGTCATCGTCGGTGATGCGGTCGTTGCCGTCATAGAGGAC[A/G]
CGGTCGATGTCGTCGAAGAAGCGTCTTACAGATTAATCTGTCAGAGGACGCGAGGTGTCCATCTATGTGGACGAGTCGGCGGCGGCGTGTTCCCATGTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	24.10%	0.04%	0.00%	NA
All Indica	2759	98.50%	1.50%	0.00%	0.00%	NA
All Japonica	1512	30.20%	69.70%	0.13%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	14.10%	85.90%	0.00%	0.00%	NA
Tropical Japonica	504	45.60%	54.00%	0.40%	0.00%	NA
Japonica Intermediate	241	49.00%	51.00%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124163322	T -> C	LOC_Os11g40480.1	downstream_gene_variant ; 1363.0bp to feature; MODIFIER	silent_mutation	Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg1124163322	T -> C	LOC_Os11g40500.1	downstream_gene_variant ; 3108.0bp to feature; MODIFIER	silent_mutation	Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg1124163322	T -> C	LOC_Os11g40500.2	downstream_gene_variant ; 3105.0bp to feature; MODIFIER	silent_mutation	Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg1124163322	T -> C	LOC_Os11g40500.3	downstream_gene_variant ; 3108.0bp to feature; MODIFIER	silent_mutation	Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg1124163322	T -> C	LOC_Os11g40490.1	intron_variant ; MODIFIER	silent_mutation	Average:62.695; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124163322	5.04E-06	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322	NA	5.73E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322	2.84E-06	2.84E-06	mr1609	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322	NA	5.90E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322	NA	7.47E-22	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322	NA	7.48E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322	2.12E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124163322	NA	1.76E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251