Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124116182:

Variant ID: vg1124116182 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24116182
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGCTGGGGATTTAGTCTAGTGGTAAGATATTCGCTTAGGGAGCGAAAGGTCCCGAGTTCAATTCTCGGAATCCCCAATCTGAAATCCCTTTTGCAATG[C/T]
ATGTCAAAGTTTTTTCTTTTCCAGAGAGAGAAATGCATGTGAAGGCTATCTATATGTTTGTATGATTTTCAGTGGTCTGGACTCTGGAGAGATGAGGTTT

Reverse complement sequence

AAACCTCATCTCTCCAGAGTCCAGACCACTGAAAATCATACAAACATATAGATAGCCTTCACATGCATTTCTCTCTCTGGAAAAGAAAAAACTTTGACAT[G/A]
CATTGCAAAAGGGATTTCAGATTGGGGATTCCGAGAATTGAACTCGGGACCTTTCGCTCCCTAAGCGAATATCTTACCACTAGACTAAATCCCCAGCTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.20%	17.40%	2.69%	33.71%	NA
All Indica	2759	37.50%	10.20%	3.81%	48.42%	NA
All Japonica	1512	53.70%	30.20%	1.32%	14.75%	NA
Aus	269	98.10%	0.40%	0.37%	1.12%	NA
Indica I	595	23.20%	0.80%	6.55%	69.41%	NA
Indica II	465	29.50%	3.00%	3.87%	63.66%	NA
Indica III	913	46.10%	21.40%	1.42%	31.11%	NA
Indica Intermediate	786	43.30%	8.70%	4.45%	43.64%	NA
Temperate Japonica	767	74.80%	14.90%	1.30%	9.00%	NA
Tropical Japonica	504	37.50%	48.20%	0.20%	14.09%	NA
Japonica Intermediate	241	20.30%	41.50%	3.73%	34.44%	NA
VI/Aromatic	96	26.00%	65.60%	0.00%	8.33%	NA
Intermediate	90	50.00%	23.30%	1.11%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124116182	C -> T	LOC_Os11g40450.1	downstream_gene_variant ; 3961.0bp to feature; MODIFIER	silent_mutation	Average:80.281; most accessible tissue: Callus, score: 92.565	N	N	N	N
vg1124116182	C -> T	LOC_Os11g40430-LOC_Os11g40450	intergenic_region ; MODIFIER	silent_mutation	Average:80.281; most accessible tissue: Callus, score: 92.565	N	N	N	N
vg1124116182	C -> DEL	N	N	silent_mutation	Average:80.281; most accessible tissue: Callus, score: 92.565	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1124116182	C	T	0.03	0.03	0.04	0.02	0.02	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124116182	NA	1.43E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	NA	9.52E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	1.35E-06	2.35E-08	mr1134	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	4.86E-06	7.98E-07	mr1135	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	NA	9.37E-06	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	NA	2.07E-06	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	7.19E-06	NA	mr1295	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	NA	7.99E-06	mr1504	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	NA	2.72E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	NA	8.26E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	NA	6.41E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	NA	4.35E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	NA	1.86E-07	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124116182	NA	6.54E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251