Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123900554:

Variant ID: vg1123900554 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23900554
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAGCTTTAAACTCTTGCTAAGTTTCCTCCAAAATTTATATATGAATGTCCATTTCATAGGAATTTCAAAGCATTGGGTATGATTCAATCTTTTGATTCA[A/T]
AGGCATCCATAGAACTTTTTTCTATAGGATTGAAATCTTTCAAAATTCATATGTTTTTCCTCTAAATCAAAAAGGCCCTTAGAGGATTTCAATCCTATAT

Reverse complement sequence

ATATAGGATTGAAATCCTCTAAGGGCCTTTTTGATTTAGAGGAAAAACATATGAATTTTGAAAGATTTCAATCCTATAGAAAAAAGTTCTATGGATGCCT[T/A]
TGAATCAAAAGATTGAATCATACCCAATGCTTTGAAATTCCTATGAAATGGACATTCATATATAAATTTTGGAGGAAACTTAGCAAGAGTTTAAAGCTAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	7.00%	0.19%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.07%	0.00%	NA
All Japonica	1512	88.00%	11.70%	0.26%	0.00%	NA
Aus	269	69.10%	29.70%	1.12%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.30%	0.13%	0.00%	NA
Temperate Japonica	767	99.10%	0.80%	0.13%	0.00%	NA
Tropical Japonica	504	67.30%	32.30%	0.40%	0.00%	NA
Japonica Intermediate	241	96.30%	3.30%	0.41%	0.00%	NA
VI/Aromatic	96	43.80%	56.20%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123900554	A -> T	LOC_Os11g40080.1	upstream_gene_variant ; 2058.0bp to feature; MODIFIER	silent_mutation	Average:34.622; most accessible tissue: Callus, score: 57.732	N	N	N	N
vg1123900554	A -> T	LOC_Os11g40070.1	downstream_gene_variant ; 4415.0bp to feature; MODIFIER	silent_mutation	Average:34.622; most accessible tissue: Callus, score: 57.732	N	N	N	N
vg1123900554	A -> T	LOC_Os11g40070.2	downstream_gene_variant ; 4415.0bp to feature; MODIFIER	silent_mutation	Average:34.622; most accessible tissue: Callus, score: 57.732	N	N	N	N
vg1123900554	A -> T	LOC_Os11g40070.3	downstream_gene_variant ; 4415.0bp to feature; MODIFIER	silent_mutation	Average:34.622; most accessible tissue: Callus, score: 57.732	N	N	N	N
vg1123900554	A -> T	LOC_Os11g40070-LOC_Os11g40080	intergenic_region ; MODIFIER	silent_mutation	Average:34.622; most accessible tissue: Callus, score: 57.732	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123900554	NA	8.90E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554	8.53E-07	8.53E-07	mr1145	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554	6.67E-06	6.67E-06	mr1204	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554	NA	5.70E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554	NA	1.44E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554	8.09E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554	NA	3.91E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554	NA	4.70E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251