Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123700733:

Variant ID: vg1123700733 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23700733
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAATCTCATAGTATCCTGATACTGCGATACGATACTATTTTAAGCAAAACGATACTACCTAGTATCCCGATAACTAATAAGCTTGGTCGCTAGTGGG[C/T]
GGTGGATTAACGGGAGAAGCAACGTGACGGTTTAATGCAGTTAATTTTTAAATCATGTTTGACCATTTATTTTATTTAAAAAGTTATATATTCATCATTT

Reverse complement sequence

AAATGATGAATATATAACTTTTTAAATAAAATAAATGGTCAAACATGATTTAAAAATTAACTGCATTAAACCGTCACGTTGCTTCTCCCGTTAATCCACC[G/A]
CCCACTAGCGACCAAGCTTATTAGTTATCGGGATACTAGGTAGTATCGTTTTGCTTAAAATAGTATCGTATCGCAGTATCAGGATACTATGAGATTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.60%	16.50%	0.13%	7.72%	NA
All Indica	2759	62.20%	26.20%	0.14%	11.45%	NA
All Japonica	1512	96.60%	2.30%	0.07%	1.06%	NA
Aus	269	96.30%	1.10%	0.00%	2.60%	NA
Indica I	595	56.60%	38.00%	0.17%	5.21%	NA
Indica II	465	72.70%	4.70%	0.22%	22.37%	NA
Indica III	913	61.00%	26.80%	0.00%	12.16%	NA
Indica Intermediate	786	61.60%	29.30%	0.25%	8.91%	NA
Temperate Japonica	767	95.80%	2.30%	0.13%	1.69%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	3.30%	0.00%	1.24%	NA
VI/Aromatic	96	78.10%	4.20%	0.00%	17.71%	NA
Intermediate	90	72.20%	16.70%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123700733	C -> T	LOC_Os11g39750.1	upstream_gene_variant ; 1155.0bp to feature; MODIFIER	silent_mutation	Average:28.158; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1123700733	C -> T	LOC_Os11g39760.1	upstream_gene_variant ; 3048.0bp to feature; MODIFIER	silent_mutation	Average:28.158; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1123700733	C -> T	LOC_Os11g39770.1	downstream_gene_variant ; 4551.0bp to feature; MODIFIER	silent_mutation	Average:28.158; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1123700733	C -> T	LOC_Os11g39740-LOC_Os11g39750	intergenic_region ; MODIFIER	silent_mutation	Average:28.158; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1123700733	C -> DEL	N	N	silent_mutation	Average:28.158; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123700733	NA	3.05E-09	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123700733	NA	2.00E-15	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123700733	NA	4.23E-11	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123700733	NA	4.40E-09	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123700733	NA	2.54E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123700733	NA	1.79E-06	mr1698	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123700733	NA	2.87E-08	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123700733	NA	1.19E-10	mr1969	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123700733	NA	2.08E-10	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123700733	NA	1.23E-07	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251