Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123329733:

Variant ID: vg1123329733 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23329733
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAACCAAGGCAGGTCAAGGGTCCAAGAGCCTTATCCTCTGAGAACGATTCTCCGACGACAAGGCTGGGGGCTAGGGAGAGTGTATGACTCAACAAACTG[A/G]
CTGATCGAAGTCGGTAAAAGAGAAGACGCTCGTACACAAAACATTGGTCTCTAAATTTAATTCATTTTCAGTTTTCCATACATATTATAACATGTCACCC

Reverse complement sequence

GGGTGACATGTTATAATATGTATGGAAAACTGAAAATGAATTAAATTTAGAGACCAATGTTTTGTGTACGAGCGTCTTCTCTTTTACCGACTTCGATCAG[T/C]
CAGTTTGTTGAGTCATACACTCTCCCTAGCCCCCAGCCTTGTCGTCGGAGAATCGTTCTCAGAGGATAAGGCTCTTGGACCCTTGACCTGCCTTGGTTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.50%	1.20%	2.79%	17.56%	NA
All Indica	2759	78.90%	0.00%	3.23%	17.80%	NA
All Japonica	1512	77.10%	3.60%	2.18%	17.06%	NA
Aus	269	82.20%	0.00%	1.86%	15.99%	NA
Indica I	595	80.20%	0.00%	2.86%	16.97%	NA
Indica II	465	65.60%	0.00%	6.24%	28.17%	NA
Indica III	913	85.80%	0.00%	1.97%	12.27%	NA
Indica Intermediate	786	78.00%	0.10%	3.18%	18.70%	NA
Temperate Japonica	767	69.60%	7.00%	3.52%	19.82%	NA
Tropical Japonica	504	88.10%	0.00%	0.40%	11.51%	NA
Japonica Intermediate	241	78.00%	0.40%	1.66%	19.92%	NA
VI/Aromatic	96	75.00%	0.00%	1.04%	23.96%	NA
Intermediate	90	78.90%	0.00%	4.44%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123329733	A -> DEL	N	N	silent_mutation	Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N
vg1123329733	A -> G	LOC_Os11g39190.1	upstream_gene_variant ; 3939.0bp to feature; MODIFIER	silent_mutation	Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N
vg1123329733	A -> G	LOC_Os11g39190.2	upstream_gene_variant ; 3930.0bp to feature; MODIFIER	silent_mutation	Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N
vg1123329733	A -> G	LOC_Os11g39190.4	upstream_gene_variant ; 3930.0bp to feature; MODIFIER	silent_mutation	Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N
vg1123329733	A -> G	LOC_Os11g39190.3	upstream_gene_variant ; 3939.0bp to feature; MODIFIER	silent_mutation	Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N
vg1123329733	A -> G	LOC_Os11g39170-LOC_Os11g39190	intergenic_region ; MODIFIER	silent_mutation	Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123329733	NA	3.62E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733	3.09E-06	NA	mr1238	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733	6.89E-06	NA	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733	4.62E-06	NA	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733	4.00E-06	NA	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733	2.30E-07	NA	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733	7.28E-06	NA	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251