Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123266458:

Variant ID: vg1123266458 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23266458
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.08, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

GTTAAATGCTGGCCATTCGAGTATGAATTCAATTTTGAAATTTAATATGCATTGTTCGGACTCAATGAATTACGTCTGATATTGGAAGATGACATGTAGT[A/T]
TATTTGAACTGAAAGTTAATGGAGAAACTAAAGAAGAAATAGTGATGATCAAAGTAGATAAAGGGGAAATACTACTCCTTACCTGATAGTGGAGACAAAG

Reverse complement sequence

CTTTGTCTCCACTATCAGGTAAGGAGTAGTATTTCCCCTTTATCTACTTTGATCATCACTATTTCTTCTTTAGTTTCTCCATTAACTTTCAGTTCAAATA[T/A]
ACTACATGTCATCTTCCAATATCAGACGTAATTCATTGAGTCCGAACAATGCATATTAAATTTCAAAATTGAATTCATACTCGAATGGCCAGCATTTAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	29.20%	0.06%	0.00%	NA
All Indica	2759	77.30%	22.60%	0.07%	0.00%	NA
All Japonica	1512	53.80%	46.20%	0.00%	0.00%	NA
Aus	269	90.70%	9.30%	0.00%	0.00%	NA
Indica I	595	70.60%	29.40%	0.00%	0.00%	NA
Indica II	465	95.50%	4.50%	0.00%	0.00%	NA
Indica III	913	76.20%	23.50%	0.22%	0.00%	NA
Indica Intermediate	786	73.00%	27.00%	0.00%	0.00%	NA
Temperate Japonica	767	24.50%	75.50%	0.00%	0.00%	NA
Tropical Japonica	504	85.70%	14.30%	0.00%	0.00%	NA
Japonica Intermediate	241	80.10%	19.90%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	75.60%	23.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123266458	A -> T	LOC_Os11g39079.1	downstream_gene_variant ; 3694.0bp to feature; MODIFIER	silent_mutation	Average:60.654; most accessible tissue: Callus, score: 96.472	N	N	N	N
vg1123266458	A -> T	LOC_Os11g39090.1	downstream_gene_variant ; 2856.0bp to feature; MODIFIER	silent_mutation	Average:60.654; most accessible tissue: Callus, score: 96.472	N	N	N	N
vg1123266458	A -> T	LOC_Os11g39090-LOC_Os11g39100	intergenic_region ; MODIFIER	silent_mutation	Average:60.654; most accessible tissue: Callus, score: 96.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123266458	NA	1.13E-16	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1123266458	NA	6.44E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458	3.45E-06	4.16E-08	mr1579	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458	NA	2.36E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458	NA	2.84E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458	NA	1.46E-07	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458	NA	1.02E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458	7.73E-06	7.72E-06	mr1579_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458	NA	4.00E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458	NA	2.31E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251