Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123203627:

Variant ID: vg1123203627 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23203627
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, A: 0.29, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AACCAGTCTCTTTGGCGACGAGGGCCTTTGGATTGGCTGCTGTTGCTTCCCTGCTAATAAGGGCTTGCCACTTGCAAGAGAGTTTGGCAGCCTTATTTCC[C/A]
ACATGTGCCATAGTGTATATATATATATTGAAATGGAATCTGAAAAGAGAGAAGGAGAGGGACGCAATTGACGCAGCTAGAAGCTGTTACTATATGTGCA

Reverse complement sequence

TGCACATATAGTAACAGCTTCTAGCTGCGTCAATTGCGTCCCTCTCCTTCTCTCTTTTCAGATTCCATTTCAATATATATATATACACTATGGCACATGT[G/T]
GGAAATAAGGCTGCCAAACTCTCTTGCAAGTGGCAAGCCCTTATTAGCAGGGAAGCAACAGCAGCCAATCCAAAGGCCCTCGTCGCCAAAGAGACTGGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 21.80% 0.53% 0.00% NA
All Indica  2759 89.80% 9.50% 0.69% 0.00% NA
All Japonica  1512 66.60% 33.30% 0.13% 0.00% NA
Aus  269 15.20% 84.40% 0.37% 0.00% NA
Indica I  595 95.60% 4.20% 0.17% 0.00% NA
Indica II  465 89.70% 8.60% 1.72% 0.00% NA
Indica III  913 88.70% 11.00% 0.33% 0.00% NA
Indica Intermediate  786 86.80% 12.30% 0.89% 0.00% NA
Temperate Japonica  767 40.70% 59.10% 0.26% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 88.40% 11.60% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 70.00% 26.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123203627 C -> A LOC_Os11g38980-LOC_Os11g38990 intergenic_region ; MODIFIER silent_mutation Average:94.31; most accessible tissue: Zhenshan97 flower, score: 99.667 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1123203627 C A -0.05 0.02 0.02 -0.02 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123203627 3.80E-10 1.02E-09 mr1238 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123203627 NA 4.41E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123203627 8.88E-06 NA mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123203627 NA 7.05E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123203627 NA 3.77E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123203627 1.13E-10 7.44E-10 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123203627 1.61E-10 9.77E-10 mr1484_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123203627 2.60E-10 8.49E-11 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123203627 1.46E-07 1.23E-06 mr1900_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123203627 NA 8.87E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251