| Variant ID: vg1122617347 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22617347 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTGTCCCAAAAATGCCATCGCCGTTAGGGTTCCGTCCATTTTGCGCCGTTAAATACACTGTTCATCCTATAGAACTTAACGGCACGGAGTGGACGGAA[C/T]
CCTAACGTCGATGGCATTTTTGGGACAAAGTTGTTTGTACGATGGCATTTCTTGGAACTCATACTTGTCGATGGCATTTCTGGGATTTGGATGCTTGTCA
TGACAAGCATCCAAATCCCAGAAATGCCATCGACAAGTATGAGTTCCAAGAAATGCCATCGTACAAACAACTTTGTCCCAAAAATGCCATCGACGTTAGG[G/A]
TTCCGTCCACTCCGTGCCGTTAAGTTCTATAGGATGAACAGTGTATTTAACGGCGCAAAATGGACGGAACCCTAACGGCGATGGCATTTTTGGGACAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.50% | 3.30% | 6.52% | 61.68% | NA |
| All Indica | 2759 | 11.30% | 0.30% | 8.74% | 79.63% | NA |
| All Japonica | 1512 | 63.50% | 9.60% | 2.18% | 24.74% | NA |
| Aus | 269 | 13.00% | 0.00% | 4.09% | 82.90% | NA |
| Indica I | 595 | 2.20% | 0.00% | 12.94% | 84.87% | NA |
| Indica II | 465 | 34.00% | 0.00% | 7.53% | 58.49% | NA |
| Indica III | 913 | 3.40% | 0.40% | 5.48% | 90.69% | NA |
| Indica Intermediate | 786 | 14.00% | 0.60% | 10.05% | 75.32% | NA |
| Temperate Japonica | 767 | 71.60% | 16.00% | 1.56% | 10.82% | NA |
| Tropical Japonica | 504 | 59.90% | 1.20% | 1.98% | 36.90% | NA |
| Japonica Intermediate | 241 | 45.20% | 6.60% | 4.56% | 43.57% | NA |
| VI/Aromatic | 96 | 11.50% | 0.00% | 14.58% | 73.96% | NA |
| Intermediate | 90 | 32.20% | 2.20% | 10.00% | 55.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122617347 | C -> T | LOC_Os11g38130.1 | upstream_gene_variant ; 4825.0bp to feature; MODIFIER | silent_mutation | Average:22.07; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1122617347 | C -> T | LOC_Os11g38140.1 | upstream_gene_variant ; 472.0bp to feature; MODIFIER | silent_mutation | Average:22.07; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1122617347 | C -> T | LOC_Os11g38150.1 | downstream_gene_variant ; 1472.0bp to feature; MODIFIER | silent_mutation | Average:22.07; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1122617347 | C -> T | LOC_Os11g38140-LOC_Os11g38150 | intergenic_region ; MODIFIER | silent_mutation | Average:22.07; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1122617347 | C -> DEL | N | N | silent_mutation | Average:22.07; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122617347 | NA | 1.50E-06 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122617347 | NA | 2.42E-06 | mr1049_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122617347 | NA | 1.29E-07 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122617347 | 3.48E-06 | 3.48E-06 | mr1981_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |