Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122506457:

Variant ID: vg1122506457 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22506457
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTTGCGTTGAGAAATGTAATACATATTAGATATCGAGACAAGCTTATAACTTTGACCATTGTTTTTTTTTAAAGTATATCACTACAAAATTAGCACCT[T/C]
ATGAAAGTATTTTCAAATAAAACTTATGATGATAAAATCCAACTTGTAAAACTAGTTTTACGATATAATCTACTTAGTATCCCCCTCTTACATAACTTAC

Reverse complement sequence

GTAAGTTATGTAAGAGGGGGATACTAAGTAGATTATATCGTAAAACTAGTTTTACAAGTTGGATTTTATCATCATAAGTTTTATTTGAAAATACTTTCAT[A/G]
AGGTGCTAATTTTGTAGTGATATACTTTAAAAAAAAACAATGGTCAAAGTTATAAGCTTGTCTCGATATCTAATATGTATTACATTTCTCAACGCAAGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.40%	0.30%	0.02%	NA
All Indica	2759	34.50%	65.00%	0.47%	0.04%	NA
All Japonica	1512	92.20%	7.70%	0.07%	0.00%	NA
Aus	269	14.90%	85.10%	0.00%	0.00%	NA
Indica I	595	20.20%	79.70%	0.17%	0.00%	NA
Indica II	465	49.00%	50.30%	0.65%	0.00%	NA
Indica III	913	33.60%	66.20%	0.22%	0.00%	NA
Indica Intermediate	786	37.80%	61.20%	0.89%	0.13%	NA
Temperate Japonica	767	93.60%	6.40%	0.00%	0.00%	NA
Tropical Japonica	504	93.10%	6.70%	0.20%	0.00%	NA
Japonica Intermediate	241	85.90%	14.10%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	55.60%	44.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122506457	T -> DEL	N	N	silent_mutation	Average:84.125; most accessible tissue: Zhenshan97 root, score: 95.113	N	N	N	N
vg1122506457	T -> C	LOC_Os11g37950.1	downstream_gene_variant ; 3348.0bp to feature; MODIFIER	silent_mutation	Average:84.125; most accessible tissue: Zhenshan97 root, score: 95.113	N	N	N	N
vg1122506457	T -> C	LOC_Os11g37960.1	intron_variant ; MODIFIER	silent_mutation	Average:84.125; most accessible tissue: Zhenshan97 root, score: 95.113	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1122506457	T	C	-0.01	-0.01	-0.01	-0.02	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122506457	NA	6.05E-07	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	1.38E-06	1.49E-10	mr1170	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	NA	1.75E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	NA	1.59E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	NA	1.52E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	NA	1.44E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	NA	3.85E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	NA	5.50E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	NA	3.42E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	NA	2.55E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	NA	6.19E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122506457	NA	1.54E-11	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251