Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122505213:

Variant ID: vg1122505213 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22505213
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATATATAAAAGTTTTTGTTTATAAATTATTTTTTAAGTCGTTAATAAATACTCCCTCCTTCCCTAAATGTTTGACACCTTTGACTTTTTTAAACATGTT[T/A]
GACCGTTCGTTTTATTCAAAAACTTTTGTGATATGTGTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATCAAATGATAGAAAAAGAATTAA

Reverse complement sequence

TTAATTCTTTTTCTATCATTTGATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTACACATATCACAAAAGTTTTTGAATAAAACGAACGGTC[A/T]
AACATGTTTAAAAAAGTCAAAGGTGTCAAACATTTAGGGAAGGAGGGAGTATTTATTAACGACTTAAAAAATAATTTATAAACAAAAACTTTTATATATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	13.10%	0.06%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	59.80%	40.10%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	50.20%	49.80%	0.00%	0.00%	NA
Tropical Japonica	504	75.60%	24.40%	0.00%	0.00%	NA
Japonica Intermediate	241	57.30%	42.30%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122505213	T -> A	LOC_Os11g37944.1	upstream_gene_variant ; 4019.0bp to feature; MODIFIER	silent_mutation	Average:46.627; most accessible tissue: Callus, score: 88.51	N	N	N	N
vg1122505213	T -> A	LOC_Os11g37960.1	upstream_gene_variant ; 780.0bp to feature; MODIFIER	silent_mutation	Average:46.627; most accessible tissue: Callus, score: 88.51	N	N	N	N
vg1122505213	T -> A	LOC_Os11g37940.1	downstream_gene_variant ; 4722.0bp to feature; MODIFIER	silent_mutation	Average:46.627; most accessible tissue: Callus, score: 88.51	N	N	N	N
vg1122505213	T -> A	LOC_Os11g37950.1	downstream_gene_variant ; 2104.0bp to feature; MODIFIER	silent_mutation	Average:46.627; most accessible tissue: Callus, score: 88.51	N	N	N	N
vg1122505213	T -> A	LOC_Os11g37950-LOC_Os11g37960	intergenic_region ; MODIFIER	silent_mutation	Average:46.627; most accessible tissue: Callus, score: 88.51	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122505213	8.04E-06	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213	1.06E-07	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213	5.28E-07	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213	NA	1.71E-07	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213	NA	1.60E-07	mr1761	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213	6.82E-06	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213	2.01E-08	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213	2.31E-07	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213	8.87E-09	NA	mr1841_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213	5.33E-08	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122505213	4.21E-06	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251