Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122503980:

Variant ID: vg1122503980 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22503980
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAACGGAAAGCTGTTATAATTTGACCGACTTCGCGTAAACGTTAAGCTCTTATCCTGACGTCACACTATAGTTCTGACTACTCCCTCTGTCCCTCCGT[C/T]
CCATAATATAAGAGATTTTGAATTTTTGTCTACACTCTTTGATCACTCGTCTTATTCAAAAAAATTTAGAATTATTATTTATTTTTTCTGTGACTTGCTT

Reverse complement sequence

AAGCAAGTCACAGAAAAAATAAATAATAATTCTAAATTTTTTTGAATAAGACGAGTGATCAAAGAGTGTAGACAAAAATTCAAAATCTCTTATATTATGG[G/A]
ACGGAGGGACAGAGGGAGTAGTCAGAACTATAGTGTGACGTCAGGATAAGAGCTTAACGTTTACGCGAAGTCGGTCAAATTATAACAGCTTTCCGTTTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 35.60% 0.11% 0.42% NA
All Indica  2759 43.60% 56.10% 0.14% 0.14% NA
All Japonica  1512 96.40% 3.40% 0.00% 0.20% NA
Aus  269 75.50% 19.30% 0.37% 4.83% NA
Indica I  595 21.00% 78.70% 0.34% 0.00% NA
Indica II  465 52.00% 48.00% 0.00% 0.00% NA
Indica III  913 53.60% 46.30% 0.11% 0.00% NA
Indica Intermediate  786 44.00% 55.30% 0.13% 0.51% NA
Temperate Japonica  767 94.50% 5.50% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 1.20% 0.00% 1.24% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122503980 C -> T LOC_Os11g37944.1 upstream_gene_variant ; 2786.0bp to feature; MODIFIER silent_mutation Average:55.509; most accessible tissue: Callus, score: 94.72 N N N N
vg1122503980 C -> T LOC_Os11g37960.1 upstream_gene_variant ; 2013.0bp to feature; MODIFIER silent_mutation Average:55.509; most accessible tissue: Callus, score: 94.72 N N N N
vg1122503980 C -> T LOC_Os11g37940.1 downstream_gene_variant ; 3489.0bp to feature; MODIFIER silent_mutation Average:55.509; most accessible tissue: Callus, score: 94.72 N N N N
vg1122503980 C -> T LOC_Os11g37950.1 downstream_gene_variant ; 871.0bp to feature; MODIFIER silent_mutation Average:55.509; most accessible tissue: Callus, score: 94.72 N N N N
vg1122503980 C -> T LOC_Os11g37950-LOC_Os11g37960 intergenic_region ; MODIFIER silent_mutation Average:55.509; most accessible tissue: Callus, score: 94.72 N N N N
vg1122503980 C -> DEL N N silent_mutation Average:55.509; most accessible tissue: Callus, score: 94.72 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122503980 C T -0.04 -0.04 -0.01 -0.04 -0.03 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122503980 7.90E-06 NA mr1170 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122503980 2.25E-06 1.37E-10 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122503980 NA 2.77E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122503980 NA 1.09E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122503980 NA 5.86E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251