| Variant ID: vg1122445799 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 22445799 |
| Reference Allele: T | Alternative Allele: C,TCTCAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA,TCTTAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.06, others allele: 0.00, population size: 94. )
ATGTAGTGTGTTGACAATTATTTTGCTCTCAATATTTATCCGCGAGATTCATGTGTTCAGTATCTATTATATACTAAAAGTCCATTAAACTTCCTACAAA[T/C,TCTCAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA,TCTTAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA]
GCTCTCAAGCCGCCACGTGGCATTCTACAAATGCTCTCATAATACCATGTGGCACTCTAATAAATTAGAGAAAATATAAGAAATATCTAGCCATTGATTT
AAATCAATGGCTAGATATTTCTTATATTTTCTCTAATTTATTAGAGTGCCACATGGTATTATGAGAGCATTTGTAGAATGCCACGTGGCGGCTTGAGAGC[A/G,TATGAGAGCATTTGTAGAATGCCACGTGGCAGCTTGAGA,TATGAGAGCATTTGTAGAATGCCACGTGGCAGCTTAAGA]
TTTGTAGGAAGTTTAATGGACTTTTAGTATATAATAGATACTGAACACATGAATCTCGCGGATAAATATTGAGAGCAAAATAATTGTCAACACACTACAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.70% | 9.30% | 3.49% | 0.04% | TCTCAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 0.42%; TCTTAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 0.02% |
| All Indica | 2759 | 94.20% | 2.60% | 2.83% | 0.07% | TCTCAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 0.29% |
| All Japonica | 1512 | 75.50% | 18.70% | 4.89% | 0.00% | TCTCAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 0.79%; TCTTAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 0.07% |
| Aus | 269 | 98.50% | 0.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.90% | 7.50% | 5.59% | 0.00% | NA |
| Indica III | 913 | 94.90% | 1.20% | 2.96% | 0.22% | TCTCAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 0.77% |
| Indica Intermediate | 786 | 93.40% | 3.30% | 3.18% | 0.00% | TCTCAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 0.13% |
| Temperate Japonica | 767 | 88.70% | 9.10% | 2.09% | 0.00% | TCTCAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 0.13% |
| Tropical Japonica | 504 | 65.70% | 28.00% | 5.36% | 0.00% | TCTCAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 0.99% |
| Japonica Intermediate | 241 | 54.40% | 29.90% | 12.86% | 0.00% | TCTCAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 2.49%; TCTTAAGCTGCCACGTGGCATTCTACAAATGCTCTCATA: 0.41% |
| VI/Aromatic | 96 | 22.90% | 71.90% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 13.30% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122445799 | T -> TCTCAAGCTGCCACGTGGCATTCTACAAAT GCTCTCATA | LOC_Os11g37870.1 | downstream_gene_variant ; 407.0bp to feature; MODIFIER | silent_mutation | Average:59.56; most accessible tissue: Callus, score: 76.724 | N | N | N | N |
| vg1122445799 | T -> TCTCAAGCTGCCACGTGGCATTCTACAAAT GCTCTCATA | LOC_Os11g37870-LOC_Os11g37880 | intergenic_region ; MODIFIER | silent_mutation | Average:59.56; most accessible tissue: Callus, score: 76.724 | N | N | N | N |
| vg1122445799 | T -> DEL | N | N | silent_mutation | Average:59.56; most accessible tissue: Callus, score: 76.724 | N | N | N | N |
| vg1122445799 | T -> TCTTAAGCTGCCACGTGGCATTCTACAAAT GCTCTCATA | LOC_Os11g37870.1 | downstream_gene_variant ; 407.0bp to feature; MODIFIER | silent_mutation | Average:59.56; most accessible tissue: Callus, score: 76.724 | N | N | N | N |
| vg1122445799 | T -> TCTTAAGCTGCCACGTGGCATTCTACAAAT GCTCTCATA | LOC_Os11g37870-LOC_Os11g37880 | intergenic_region ; MODIFIER | silent_mutation | Average:59.56; most accessible tissue: Callus, score: 76.724 | N | N | N | N |
| vg1122445799 | T -> C | LOC_Os11g37870.1 | downstream_gene_variant ; 406.0bp to feature; MODIFIER | silent_mutation | Average:59.56; most accessible tissue: Callus, score: 76.724 | N | N | N | N |
| vg1122445799 | T -> C | LOC_Os11g37870-LOC_Os11g37880 | intergenic_region ; MODIFIER | silent_mutation | Average:59.56; most accessible tissue: Callus, score: 76.724 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122445799 | 1.25E-06 | 1.59E-06 | mr1062 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | NA | 6.20E-07 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | NA | 4.72E-06 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | NA | 1.21E-07 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | 6.91E-06 | 6.91E-06 | mr1377 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | NA | 1.30E-06 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | NA | 2.49E-06 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | 5.12E-06 | 1.52E-11 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | NA | 1.64E-08 | mr1896 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | NA | 9.02E-09 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | NA | 2.07E-11 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122445799 | NA | 3.34E-06 | mr1958 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |