Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122410940:

Variant ID: vg1122410940 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22410940
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, G: 0.07, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTGGCCGCTGTGCCGTGGCGTGAGCTTGGCCATCGGCATGCAGATAACACCACTATACGTCCACTGAGGTCTGGACTTTTTGGCTATATACCTATGGA[C/G]
AGAGACAGGGGATGTAACCCATTTTCATTATCTAAAAAAAATATGTCCACTGAGGTCTCGACCAAGGCCCTCGCTGCATTTAACAGGTGGTCATCGCGTG

Reverse complement sequence

CACGCGATGACCACCTGTTAAATGCAGCGAGGGCCTTGGTCGAGACCTCAGTGGACATATTTTTTTTAGATAATGAAAATGGGTTACATCCCCTGTCTCT[G/C]
TCCATAGGTATATAGCCAAAAAGTCCAGACCTCAGTGGACGTATAGTGGTGTTATCTGCATGCCGATGGCCAAGCTCACGCCACGGCACAGCGGCCACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	12.80%	0.68%	53.98%	NA
All Indica	2759	19.20%	14.00%	0.94%	65.86%	NA
All Japonica	1512	61.50%	12.40%	0.20%	25.93%	NA
Aus	269	17.80%	0.00%	0.37%	81.78%	NA
Indica I	595	41.30%	11.60%	1.18%	45.88%	NA
Indica II	465	24.50%	1.70%	1.08%	72.69%	NA
Indica III	913	1.30%	26.70%	0.55%	71.41%	NA
Indica Intermediate	786	20.10%	8.30%	1.15%	70.48%	NA
Temperate Japonica	767	76.70%	12.10%	0.00%	11.21%	NA
Tropical Japonica	504	52.00%	5.60%	0.40%	42.06%	NA
Japonica Intermediate	241	33.20%	27.40%	0.41%	39.00%	NA
VI/Aromatic	96	3.10%	19.80%	0.00%	77.08%	NA
Intermediate	90	31.10%	13.30%	2.22%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122410940	C -> DEL	N	N	silent_mutation	Average:17.426; most accessible tissue: Callus, score: 96.003	N	N	N	N
vg1122410940	C -> G	LOC_Os11g37830.1	upstream_gene_variant ; 4108.0bp to feature; MODIFIER	silent_mutation	Average:17.426; most accessible tissue: Callus, score: 96.003	N	N	N	N
vg1122410940	C -> G	LOC_Os11g37840.1	upstream_gene_variant ; 2562.0bp to feature; MODIFIER	silent_mutation	Average:17.426; most accessible tissue: Callus, score: 96.003	N	N	N	N
vg1122410940	C -> G	LOC_Os11g37830-LOC_Os11g37840	intergenic_region ; MODIFIER	silent_mutation	Average:17.426; most accessible tissue: Callus, score: 96.003	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122410940	NA	7.32E-07	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410940	NA	3.16E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410940	6.84E-07	6.83E-07	mr1597	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410940	8.75E-06	8.76E-06	mr1994	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410940	3.79E-06	3.05E-10	mr1438_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410940	NA	7.71E-08	mr1994_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251