Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122410899:

Variant ID: vg1122410899 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22410899
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.40, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAAATACTCTTTCAACAAGGGACCAATCCCTCCGCATGCATGTGGCCGCTGTGCCGTGGCGTGAGCTTGGCCATCGGCATGCAGATAACACCACTATA[C/T]
GTCCACTGAGGTCTGGACTTTTTGGCTATATACCTATGGACAGAGACAGGGGATGTAACCCATTTTCATTATCTAAAAAAAATATGTCCACTGAGGTCTC

Reverse complement sequence

GAGACCTCAGTGGACATATTTTTTTTAGATAATGAAAATGGGTTACATCCCCTGTCTCTGTCCATAGGTATATAGCCAAAAAGTCCAGACCTCAGTGGAC[G/A]
TATAGTGGTGTTATCTGCATGCCGATGGCCAAGCTCACGCCACGGCACAGCGGCCACATGCATGCGGAGGGATTGGTCCCTTGTTGAAAGAGTATTTTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	12.80%	0.59%	54.02%	NA
All Indica	2759	19.20%	14.00%	0.83%	65.97%	NA
All Japonica	1512	61.50%	12.40%	0.13%	25.93%	NA
Aus	269	18.20%	0.00%	0.37%	81.41%	NA
Indica I	595	40.80%	11.60%	1.01%	46.55%	NA
Indica II	465	24.50%	1.70%	1.08%	72.69%	NA
Indica III	913	1.20%	26.80%	0.33%	71.63%	NA
Indica Intermediate	786	20.50%	8.30%	1.15%	70.10%	NA
Temperate Japonica	767	76.50%	12.30%	0.13%	11.08%	NA
Tropical Japonica	504	52.20%	5.60%	0.20%	42.06%	NA
Japonica Intermediate	241	33.20%	27.40%	0.00%	39.42%	NA
VI/Aromatic	96	3.10%	19.80%	0.00%	77.08%	NA
Intermediate	90	31.10%	13.30%	2.22%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122410899	C -> T	LOC_Os11g37830.1	upstream_gene_variant ; 4067.0bp to feature; MODIFIER	silent_mutation	Average:15.616; most accessible tissue: Callus, score: 77.326	N	N	N	N
vg1122410899	C -> T	LOC_Os11g37840.1	upstream_gene_variant ; 2603.0bp to feature; MODIFIER	silent_mutation	Average:15.616; most accessible tissue: Callus, score: 77.326	N	N	N	N
vg1122410899	C -> T	LOC_Os11g37830-LOC_Os11g37840	intergenic_region ; MODIFIER	silent_mutation	Average:15.616; most accessible tissue: Callus, score: 77.326	N	N	N	N
vg1122410899	C -> DEL	N	N	silent_mutation	Average:15.616; most accessible tissue: Callus, score: 77.326	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122410899	NA	1.15E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899	NA	1.03E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899	NA	5.92E-06	mr1332	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899	NA	3.10E-06	mr1438	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899	1.70E-06	1.70E-06	mr1545	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899	3.76E-06	7.09E-07	mr1579	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899	NA	1.40E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899	9.34E-06	9.33E-06	mr1701	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899	NA	1.14E-06	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122410899	NA	5.78E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251