Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122217828:

Variant ID: vg1122217828 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22217828
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTCTTGTAATAATTGTTGTAAGGAATGGCATGCTGCATTCACATTTTTTTTCTGGGTTCAGTCTTTGTTGTCGCCTTTATTCCTGGCTCCAGGTAGGT[G/A]
TAATCAGATAGATCAAAGATATACCTTTCTTTAAAGAAAAGAAGAGAACTCTGTATGCAATTAATCGATGGTGTAGTTTAGTAACCAGTTGAGTGAACCA

Reverse complement sequence

TGGTTCACTCAACTGGTTACTAAACTACACCATCGATTAATTGCATACAGAGTTCTCTTCTTTTCTTTAAAGAAAGGTATATCTTTGATCTATCTGATTA[C/T]
ACCTACCTGGAGCCAGGAATAAAGGCGACAACAAAGACTGAACCCAGAAAAAAAATGTGAATGCAGCATGCCATTCCTTACAACAATTATTACAAGAAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 29.20% 0.04% 0.02% NA
All Indica  2759 82.80% 17.10% 0.04% 0.04% NA
All Japonica  1512 42.10% 57.90% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 64.50% 35.30% 0.00% 0.17% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 83.90% 16.00% 0.11% 0.00% NA
Indica Intermediate  786 86.50% 13.50% 0.00% 0.00% NA
Temperate Japonica  767 33.50% 66.50% 0.00% 0.00% NA
Tropical Japonica  504 54.20% 45.80% 0.00% 0.00% NA
Japonica Intermediate  241 44.00% 55.60% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122217828 G -> A LOC_Os11g37640.1 intron_variant ; MODIFIER silent_mutation Average:54.842; most accessible tissue: Zhenshan97 flower, score: 93.052 N N N N
vg1122217828 G -> DEL N N silent_mutation Average:54.842; most accessible tissue: Zhenshan97 flower, score: 93.052 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122217828 G A -0.04 -0.01 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122217828 1.85E-06 NA mr1081 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122217828 NA 1.48E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251