Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122138317:

Variant ID: vg1122138317 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22138317
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTACATGGGCCCCATATGTCATCCTCTCCTTCCGTCTTCCCACTATCCTCTCTCTCTCTCTCTTCTTCCCTACGGGGCGACGGGCGGAGTAGAGCGACGG[C/T]
GGCCGAAGCGGCGGAGCGCGAAGCCAGCAGGGCGGCGGCGGGAATCGGCATCACCTTGGACGTCTTCTCGTCGGAGACCAACGAATGGGCGAAGCGCGAT

Reverse complement sequence

ATCGCGCTTCGCCCATTCGTTGGTCTCCGACGAGAAGACGTCCAAGGTGATGCCGATTCCCGCCGCCGCCCTGCTGGCTTCGCGCTCCGCCGCTTCGGCC[G/A]
CCGTCGCTCTACTCCGCCCGTCGCCCCGTAGGGAAGAAGAGAGAGAGAGAGAGGATAGTGGGAAGACGGAAGGAGAGGATGACATATGGGGCCCATGTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	45.30%	0.28%	4.42%	NA
All Indica	2759	22.10%	74.20%	0.14%	3.62%	NA
All Japonica	1512	95.00%	3.20%	0.33%	1.46%	NA
Aus	269	72.90%	2.20%	1.12%	23.79%	NA
Indica I	595	42.70%	57.30%	0.00%	0.00%	NA
Indica II	465	4.50%	95.30%	0.00%	0.22%	NA
Indica III	913	21.50%	71.30%	0.44%	6.79%	NA
Indica Intermediate	786	17.60%	77.70%	0.00%	4.71%	NA
Temperate Japonica	767	96.10%	3.30%	0.52%	0.13%	NA
Tropical Japonica	504	93.70%	3.40%	0.20%	2.78%	NA
Japonica Intermediate	241	94.20%	2.90%	0.00%	2.90%	NA
VI/Aromatic	96	72.90%	8.30%	1.04%	17.71%	NA
Intermediate	90	56.70%	36.70%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122138317	C -> T	LOC_Os11g37490.1	upstream_gene_variant ; 3098.0bp to feature; MODIFIER	silent_mutation	Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057	N	N	N	N
vg1122138317	C -> T	LOC_Os11g37510.1	upstream_gene_variant ; 1601.0bp to feature; MODIFIER	silent_mutation	Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057	N	N	N	N
vg1122138317	C -> T	LOC_Os11g37500.1	downstream_gene_variant ; 1697.0bp to feature; MODIFIER	silent_mutation	Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057	N	N	N	N
vg1122138317	C -> T	LOC_Os11g37500-LOC_Os11g37510	intergenic_region ; MODIFIER	silent_mutation	Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057	N	N	N	N
vg1122138317	C -> DEL	N	N	silent_mutation	Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122138317	NA	7.65E-07	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317	NA	6.93E-10	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317	NA	2.77E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317	NA	3.33E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317	2.80E-06	NA	mr1538	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317	NA	1.24E-18	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317	NA	1.00E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317	NA	7.04E-11	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317	NA	2.51E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251