Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122057994:

Variant ID: vg1122057994 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22057994
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGACACGGCGTGGTAAAAAAACAAATCGAATCCGATTCCATCAACGCGGTAAAAAAAACAAGCGTAAAATTTTTTTCTGTCCGATTCCAAAAAAAAGTA[C/T]
GAAAAAAGTTTTTCGTTTCTCTTTCTCTATCTATCTGTATATTTATCTCTATCTCTACTACTTAAAAATTAAAAAGTGTTTCCGTCGTCCATCCGTGAAA

Reverse complement sequence

TTTCACGGATGGACGACGGAAACACTTTTTAATTTTTAAGTAGTAGAGATAGAGATAAATATACAGATAGATAGAGAAAGAGAAACGAAAAACTTTTTTC[G/A]
TACTTTTTTTTGGAATCGGACAGAAAAAAATTTTACGCTTGTTTTTTTTACCGCGTTGATGGAATCGGATTCGATTTGTTTTTTTACCACGCCGTGTCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.90%	17.10%	0.19%	4.80%	NA
All Indica	2759	73.70%	22.40%	0.18%	3.73%	NA
All Japonica	1512	85.80%	11.60%	0.13%	2.38%	NA
Aus	269	74.30%	0.40%	0.37%	24.91%	NA
Indica I	595	64.70%	35.10%	0.00%	0.17%	NA
Indica II	465	98.10%	1.50%	0.00%	0.43%	NA
Indica III	913	64.60%	27.70%	0.44%	7.23%	NA
Indica Intermediate	786	76.60%	19.00%	0.13%	4.33%	NA
Temperate Japonica	767	96.20%	3.10%	0.26%	0.39%	NA
Tropical Japonica	504	69.20%	25.60%	0.00%	5.16%	NA
Japonica Intermediate	241	87.60%	9.50%	0.00%	2.90%	NA
VI/Aromatic	96	82.30%	1.00%	1.04%	15.62%	NA
Intermediate	90	77.80%	15.60%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122057994	C -> T	LOC_Os11g37380.1	upstream_gene_variant ; 3633.0bp to feature; MODIFIER	silent_mutation	Average:18.569; most accessible tissue: Callus, score: 32.366	N	N	N	N
vg1122057994	C -> T	LOC_Os11g37360.1	downstream_gene_variant ; 4797.0bp to feature; MODIFIER	silent_mutation	Average:18.569; most accessible tissue: Callus, score: 32.366	N	N	N	N
vg1122057994	C -> T	LOC_Os11g37370.1	downstream_gene_variant ; 2537.0bp to feature; MODIFIER	silent_mutation	Average:18.569; most accessible tissue: Callus, score: 32.366	N	N	N	N
vg1122057994	C -> T	LOC_Os11g37370-LOC_Os11g37380	intergenic_region ; MODIFIER	silent_mutation	Average:18.569; most accessible tissue: Callus, score: 32.366	N	N	N	N
vg1122057994	C -> DEL	N	N	silent_mutation	Average:18.569; most accessible tissue: Callus, score: 32.366	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122057994	NA	8.16E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	7.43E-07	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	8.17E-07	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	1.39E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	1.38E-07	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	3.64E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	6.62E-06	mr1043_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	1.50E-08	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	7.37E-06	mr1479_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	1.63E-08	mr1726_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	7.80E-06	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122057994	NA	1.52E-06	mr1950_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251