Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121911743:

Variant ID: vg1121911743 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21911743
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGGTCTTGACGCCGTTGGAGCAGACGCTGCACCGGCTCTACATCCAAGCAATGAGGAAGAGAGGACAGAGAGTGAAGAGAGATGGAGAGCTGACATATG[A/G]
GTCTAGGGGTATTTCTAATATTTTACATGATTTCTCTCCCCTTTCCAACCGAAAATTATTATTTTAATGGGTTACGGTGTCCACCAGTAAATATCCAACT

Reverse complement sequence

AGTTGGATATTTACTGGTGGACACCGTAACCCATTAAAATAATAATTTTCGGTTGGAAAGGGGAGAGAAATCATGTAAAATATTAGAAATACCCCTAGAC[T/C]
CATATGTCAGCTCTCCATCTCTCTTCACTCTCTGTCCTCTCTTCCTCATTGCTTGGATGTAGAGCCGGTGCAGCGTCTGCTCCAACGGCGTCAAGACCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 22.00% 0.08% 3.17% NA
All Indica  2759 96.00% 1.40% 0.04% 2.50% NA
All Japonica  1512 34.50% 64.70% 0.07% 0.66% NA
Aus  269 79.20% 1.50% 0.37% 18.96% NA
Indica I  595 98.30% 1.30% 0.00% 0.34% NA
Indica II  465 99.40% 0.40% 0.00% 0.22% NA
Indica III  913 92.80% 1.30% 0.11% 5.81% NA
Indica Intermediate  786 96.20% 2.20% 0.00% 1.65% NA
Temperate Japonica  767 18.50% 81.50% 0.00% 0.00% NA
Tropical Japonica  504 64.50% 34.10% 0.00% 1.39% NA
Japonica Intermediate  241 22.80% 75.50% 0.41% 1.24% NA
VI/Aromatic  96 81.20% 0.00% 1.04% 17.71% NA
Intermediate  90 77.80% 18.90% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121911743 A -> DEL N N silent_mutation Average:62.313; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg1121911743 A -> G LOC_Os11g37110.1 upstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:62.313; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg1121911743 A -> G LOC_Os11g37100.1 downstream_gene_variant ; 2476.0bp to feature; MODIFIER silent_mutation Average:62.313; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg1121911743 A -> G LOC_Os11g37120.1 downstream_gene_variant ; 1169.0bp to feature; MODIFIER silent_mutation Average:62.313; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg1121911743 A -> G LOC_Os11g37110-LOC_Os11g37120 intergenic_region ; MODIFIER silent_mutation Average:62.313; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121911743 A G 0.0 0.0 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121911743 NA 1.50E-12 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 3.47E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 4.65E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 1.59E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 4.77E-07 NA mr1517 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 3.07E-06 mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 4.37E-06 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 7.77E-07 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 1.11E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 4.02E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 3.95E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 1.57E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 5.97E-06 3.14E-22 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 1.75E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 7.87E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 2.75E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 1.49E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 9.31E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 9.88E-06 8.49E-36 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 2.70E-09 mr1780 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 2.83E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 4.76E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 3.31E-22 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 1.46E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 6.20E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 1.04E-06 1.04E-06 mr1760_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 6.00E-06 NA mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121911743 NA 4.61E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251