Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121673447:

Variant ID: vg1121673447 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21673447
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAGTAGCTAGTACGCACGGCTTGCTGGAGCGAGGTCCTCAGTTCGATCCCCTACCAGCGCACAAGCTAATCCTCACCCTAGTTTACATTTTCATAGGC[A/G]
AACATTTGGCTCCGAGAGACATTTTGAAACTGGGGATGAGTTGCGGCCTTTTCCGATCTGTCTATAATCCGTGCTACCTTGGCCCTGTTTGGTTCCATGG

Reverse complement sequence

CCATGGAACCAAACAGGGCCAAGGTAGCACGGATTATAGACAGATCGGAAAAGGCCGCAACTCATCCCCAGTTTCAAAATGTCTCTCGGAGCCAAATGTT[T/C]
GCCTATGAAAATGTAAACTAGGGTGAGGATTAGCTTGTGCGCTGGTAGGGGATCGAACTGAGGACCTCGCTCCAGCAAGCCGTGCGTACTAGCTACTTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	13.90%	0.97%	35.46%	NA
All Indica	2759	39.30%	14.60%	1.41%	44.69%	NA
All Japonica	1512	70.60%	10.60%	0.33%	18.39%	NA
Aus	269	55.00%	24.20%	0.00%	20.82%	NA
Indica I	595	21.80%	47.40%	1.01%	29.75%	NA
Indica II	465	42.80%	3.00%	1.94%	52.26%	NA
Indica III	913	44.20%	4.40%	1.42%	49.95%	NA
Indica Intermediate	786	44.70%	8.50%	1.40%	45.42%	NA
Temperate Japonica	767	82.70%	7.80%	0.39%	9.13%	NA
Tropical Japonica	504	54.80%	16.50%	0.40%	28.37%	NA
Japonica Intermediate	241	65.60%	7.50%	0.00%	26.97%	NA
VI/Aromatic	96	6.20%	6.20%	1.04%	86.46%	NA
Intermediate	90	47.80%	22.20%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121673447	A -> DEL	N	N	silent_mutation	Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg1121673447	A -> G	LOC_Os11g36719.1	upstream_gene_variant ; 1580.0bp to feature; MODIFIER	silent_mutation	Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg1121673447	A -> G	LOC_Os11g36700.1	downstream_gene_variant ; 475.0bp to feature; MODIFIER	silent_mutation	Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg1121673447	A -> G	LOC_Os11g36700-LOC_Os11g36719	intergenic_region ; MODIFIER	silent_mutation	Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121673447	NA	9.21E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447	NA	1.80E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447	NA	2.21E-06	mr1031	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447	NA	4.09E-07	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447	NA	1.38E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447	NA	3.94E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447	NA	1.61E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447	NA	1.43E-06	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447	NA	5.86E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447	NA	1.93E-06	mr1986	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251