Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121614615:

Variant ID: vg1121614615 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21614615
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGATTTCCTTAGAGTACGCAGGAAGTATCCGTATGCGCGTGGATATACCATACCGATATGTAACGTATATTAAAGGGTAAAGGGTATGCCTAACCCGTA[G/A]
CCCTGACAGTAGCCCCCGACTTCTGCTTAAAATGAACTCGTGTAACCATTCGCGACTTCGGGTGTCGAGACTGTTGTCGTTCCTAGTGCGAGGACCGCGG

Reverse complement sequence

CCGCGGTCCTCGCACTAGGAACGACAACAGTCTCGACACCCGAAGTCGCGAATGGTTACACGAGTTCATTTTAAGCAGAAGTCGGGGGCTACTGTCAGGG[C/T]
TACGGGTTAGGCATACCCTTTACCCTTTAATATACGTTACATATCGGTATGGTATATCCACGCGCATACGGATACTTCCTGCGTACTCTAAGGAAATCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.50%	20.60%	2.79%	47.14%	NA
All Indica	2759	8.70%	32.80%	3.23%	55.27%	NA
All Japonica	1512	71.40%	2.80%	1.65%	24.07%	NA
Aus	269	13.40%	1.90%	2.23%	82.53%	NA
Indica I	595	15.80%	12.40%	3.70%	68.07%	NA
Indica II	465	6.70%	53.30%	4.52%	35.48%	NA
Indica III	913	2.30%	35.00%	1.97%	60.68%	NA
Indica Intermediate	786	12.00%	33.50%	3.56%	51.02%	NA
Temperate Japonica	767	81.90%	0.80%	1.30%	16.04%	NA
Tropical Japonica	504	56.90%	6.00%	0.99%	36.11%	NA
Japonica Intermediate	241	68.50%	2.90%	4.15%	24.48%	NA
VI/Aromatic	96	3.10%	7.30%	10.42%	79.17%	NA
Intermediate	90	37.80%	14.40%	2.22%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121614615	G -> A	LOC_Os11g36610.1	upstream_gene_variant ; 4944.0bp to feature; MODIFIER	silent_mutation	Average:8.969; most accessible tissue: Callus, score: 30.436	N	N	N	N
vg1121614615	G -> A	LOC_Os11g36630.1	upstream_gene_variant ; 400.0bp to feature; MODIFIER	silent_mutation	Average:8.969; most accessible tissue: Callus, score: 30.436	N	N	N	N
vg1121614615	G -> A	LOC_Os11g36620.1	downstream_gene_variant ; 2660.0bp to feature; MODIFIER	silent_mutation	Average:8.969; most accessible tissue: Callus, score: 30.436	N	N	N	N
vg1121614615	G -> A	LOC_Os11g36640.1	downstream_gene_variant ; 4397.0bp to feature; MODIFIER	silent_mutation	Average:8.969; most accessible tissue: Callus, score: 30.436	N	N	N	N
vg1121614615	G -> A	LOC_Os11g36620-LOC_Os11g36630	intergenic_region ; MODIFIER	silent_mutation	Average:8.969; most accessible tissue: Callus, score: 30.436	N	N	N	N
vg1121614615	G -> DEL	N	N	silent_mutation	Average:8.969; most accessible tissue: Callus, score: 30.436	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121614615	NA	1.23E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121614615	NA	9.19E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121614615	4.73E-06	4.73E-06	mr1171_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121614615	1.99E-06	2.79E-06	mr1525_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121614615	3.17E-06	3.09E-06	mr1708_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121614615	NA	1.26E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121614615	2.63E-06	NA	mr1754_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121614615	3.72E-06	3.72E-06	mr1891_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251