Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121246644:

Variant ID: vg1121246644 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21246644
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGACACGGCCCGGGTGGCGGCGGCTGCAGACGACGCCCGGCCAGCTGCAGTGATGGATGGAACTAGTACTATTCCATGAGGCCAGCGGCGAGCTGGATG[G/A]
GCTCGAGAGCATGGACTTAATGGAGAGCAGCGCGAGCTCGTCGACGGTGGCCTTTGTTGCGTCGTTGCTGCTCACCGGAGAAGAAGGAGGAGGAGGAGGA

Reverse complement sequence

TCCTCCTCCTCCTCCTTCTTCTCCGGTGAGCAGCAACGACGCAACAAAGGCCACCGTCGACGAGCTCGCGCTGCTCTCCATTAAGTCCATGCTCTCGAGC[C/T]
CATCCAGCTCGCCGCTGGCCTCATGGAATAGTACTAGTTCCATCCATCACTGCAGCTGGCCGGGCGTCGTCTGCAGCCGCCGCCACCCGGGCCGTGTCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.30%	5.10%	0.02%	0.61%	NA
All Indica	2759	99.20%	0.50%	0.04%	0.18%	NA
All Japonica	1512	88.40%	11.50%	0.00%	0.07%	NA
Aus	269	81.80%	10.40%	0.00%	7.81%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.10%	0.11%	0.22%	NA
Indica Intermediate	786	98.70%	0.90%	0.00%	0.38%	NA
Temperate Japonica	767	89.60%	10.40%	0.00%	0.00%	NA
Tropical Japonica	504	86.50%	13.50%	0.00%	0.00%	NA
Japonica Intermediate	241	88.80%	10.80%	0.00%	0.41%	NA
VI/Aromatic	96	80.20%	18.80%	0.00%	1.04%	NA
Intermediate	90	92.20%	6.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121246644	G -> A	LOC_Os11g36140.1	missense_variant ; p.Pro58Ser; MODERATE	nonsynonymous_codon ; P58S	Average:78.485; most accessible tissue: Zhenshan97 flag leaf, score: 89.557	possibly damaging	1.831	TOLERATED	0.52
vg1121246644	G -> DEL	LOC_Os11g36140.1	N	frameshift_variant	Average:78.485; most accessible tissue: Zhenshan97 flag leaf, score: 89.557	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1121246644	G	A	-0.03	-0.05	-0.08	-0.07	-0.07	-0.08

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121246644	5.88E-07	NA	mr1672_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251