Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120734654:

Variant ID: vg1120734654 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20734654
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGTGCCCAGACGAAAAAAACGAAAAATACGCACGCAAGCGCCATGCAAAATCAGCAAAAAAAAAAATCAGCCCACCAAGTATCTAACCCAAGCACTCA[G/A]
CCTTCAAACCTCGCTGCACTAGCCATTTGAGCTCTGTTTGCTTCTCAAATGAATGCACCCGCACCCTCATTTAATAGGGGCAAACATGGAAGAATAGTCT

Reverse complement sequence

AGACTATTCTTCCATGTTTGCCCCTATTAAATGAGGGTGCGGGTGCATTCATTTGAGAAGCAAACAGAGCTCAAATGGCTAGTGCAGCGAGGTTTGAAGG[C/T]
TGAGTGCTTGGGTTAGATACTTGGTGGGCTGATTTTTTTTTTTGCTGATTTTGCATGGCGCTTGCGTGCGTATTTTTCGTTTTTTTCGTCTGGGCACTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	6.30%	0.44%	0.91%	NA
All Indica	2759	93.90%	4.40%	0.29%	1.45%	NA
All Japonica	1512	98.10%	1.30%	0.66%	0.00%	NA
Aus	269	41.60%	56.90%	0.37%	1.12%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	86.70%	13.10%	0.22%	0.00%	NA
Indica III	913	95.30%	1.30%	0.44%	2.96%	NA
Indica Intermediate	786	92.00%	6.00%	0.38%	1.65%	NA
Temperate Japonica	767	97.70%	2.20%	0.13%	0.00%	NA
Tropical Japonica	504	98.20%	0.00%	1.79%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120734654	G -> A	LOC_Os11g35380.1	upstream_gene_variant ; 302.0bp to feature; MODIFIER	silent_mutation	Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1120734654	G -> A	LOC_Os11g35360.1	downstream_gene_variant ; 3113.0bp to feature; MODIFIER	silent_mutation	Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1120734654	G -> A	LOC_Os11g35370.1	downstream_gene_variant ; 1975.0bp to feature; MODIFIER	silent_mutation	Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1120734654	G -> A	LOC_Os11g35390.1	downstream_gene_variant ; 437.0bp to feature; MODIFIER	silent_mutation	Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1120734654	G -> A	LOC_Os11g35360.2	downstream_gene_variant ; 3113.0bp to feature; MODIFIER	silent_mutation	Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1120734654	G -> A	LOC_Os11g35380-LOC_Os11g35390	intergenic_region ; MODIFIER	silent_mutation	Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1120734654	G -> DEL	N	N	silent_mutation	Average:37.174; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120734654	NA	1.65E-06	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654	NA	1.03E-09	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654	NA	2.12E-10	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654	7.09E-07	1.01E-12	mr1889	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654	1.09E-06	3.14E-11	mr1896	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654	NA	6.18E-10	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120734654	NA	2.79E-12	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251