Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120332797:

Variant ID: vg1120332797 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20332797
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAGGAATATTAGAAGAGGAGACTAGAGTCCATATAGAAATACAATTTAAAAATAGTTGAAATTCGGAATTAAAAAATAAGGAATATTAGAAGAGGAGA[C/T]
TAGAGTCCATATAGATATACAATTAGAAAATAACTGAAATTAGGAATTAAAAATAAGGAATATTAGAAGTAGAGTATATATTCCATATAGAAATACAATT

Reverse complement sequence

AATTGTATTTCTATATGGAATATATACTCTACTTCTAATATTCCTTATTTTTAATTCCTAATTTCAGTTATTTTCTAATTGTATATCTATATGGACTCTA[G/A]
TCTCCTCTTCTAATATTCCTTATTTTTTAATTCCGAATTTCAACTATTTTTAAATTGTATTTCTATATGGACTCTAGTCTCCTCTTCTAATATTCCTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	8.90%	0.06%	0.00%	NA
All Indica	2759	88.60%	11.30%	0.07%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	60.20%	39.40%	0.37%	0.00%	NA
Indica I	595	76.00%	24.00%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	91.80%	8.10%	0.11%	0.00%	NA
Indica Intermediate	786	89.60%	10.30%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120332797	C -> T	LOC_Os11g34700.1	downstream_gene_variant ; 663.0bp to feature; MODIFIER	silent_mutation	Average:23.308; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1120332797	C -> T	LOC_Os11g34710.1	downstream_gene_variant ; 3967.0bp to feature; MODIFIER	silent_mutation	Average:23.308; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1120332797	C -> T	LOC_Os11g34700-LOC_Os11g34710	intergenic_region ; MODIFIER	silent_mutation	Average:23.308; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120332797	NA	6.54E-08	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120332797	NA	1.17E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120332797	NA	7.02E-09	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120332797	NA	2.60E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120332797	7.59E-07	NA	mr1505	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120332797	NA	2.79E-09	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120332797	NA	1.42E-09	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120332797	NA	5.05E-09	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120332797	NA	1.29E-08	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251