Variant ID: vg1120079549 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 20079549 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )
TTTAGTTGGATAATTACGACCAATGAAACATGGCCGGATGTCTCGAGCATGCAGCTCGTCTAGATACTAAGAGGTCTAATAATGTAATTAACACATCAAC[C/T]
GAGCTAGTGGTAATTAAGCATGGCTAAGCACATAGTTCTAGCTAGGTTACATAAGTAACACGAGCTAGTCGAATTATCACCCAAGTTTAATAAAGGACGG
CCGTCCTTTATTAAACTTGGGTGATAATTCGACTAGCTCGTGTTACTTATGTAACCTAGCTAGAACTATGTGCTTAGCCATGCTTAATTACCACTAGCTC[G/A]
GTTGATGTGTTAATTACATTATTAGACCTCTTAGTATCTAGACGAGCTGCATGCTCGAGACATCCGGCCATGTTTCATTGGTCGTAATTATCCAACTAAA
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 78.10% | 15.70% | 0.00% | 6.24% | NA |
All Indica | 2759 | 98.90% | 1.00% | 0.00% | 0.14% | NA |
All Japonica | 1512 | 39.90% | 41.00% | 0.00% | 19.05% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.60% | 0.00% | 0.22% | NA |
Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
Indica Intermediate | 786 | 97.30% | 2.40% | 0.00% | 0.25% | NA |
Temperate Japonica | 767 | 20.60% | 62.50% | 0.00% | 16.95% | NA |
Tropical Japonica | 504 | 55.80% | 14.70% | 0.00% | 29.56% | NA |
Japonica Intermediate | 241 | 68.50% | 27.80% | 0.00% | 3.73% | NA |
VI/Aromatic | 96 | 31.20% | 67.70% | 0.00% | 1.04% | NA |
Intermediate | 90 | 67.80% | 30.00% | 0.00% | 2.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1120079549 | C -> T | LOC_Os11g34290.1 | upstream_gene_variant ; 4848.0bp to feature; MODIFIER | silent_mutation | Average:57.699; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
vg1120079549 | C -> T | LOC_Os11g34270.1 | downstream_gene_variant ; 4818.0bp to feature; MODIFIER | silent_mutation | Average:57.699; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
vg1120079549 | C -> T | LOC_Os11g34280.1 | downstream_gene_variant ; 1988.0bp to feature; MODIFIER | silent_mutation | Average:57.699; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
vg1120079549 | C -> T | LOC_Os11g34280-LOC_Os11g34290 | intergenic_region ; MODIFIER | silent_mutation | Average:57.699; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
vg1120079549 | C -> DEL | N | N | silent_mutation | Average:57.699; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1120079549 | NA | 1.83E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1120079549 | NA | 1.11E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1120079549 | NA | 3.34E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1120079549 | NA | 3.74E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1120079549 | NA | 1.75E-07 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1120079549 | NA | 1.68E-06 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1120079549 | 1.22E-06 | NA | mr1807_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1120079549 | 8.25E-06 | NA | mr1807_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1120079549 | NA | 1.73E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1120079549 | NA | 3.86E-16 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1120079549 | NA | 3.60E-17 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |