Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119658949:

Variant ID: vg1119658949 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19658949
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGTCGATCAAATTACCCCTGAGCTATTGTGGTCGATCAAATTACCCCCTAACCCGAAAACCAAACATTGTTCACCTTGAACTTATAATGCATGACAAA[T/C]
TACCCTGGTTTATCCTAAGTGGCATACGCGTGAAATCCAGTCAGCACTTTTTTTAAAAAAAAACAATGATGAGACCCACCTATCATACCTCATCTTCCCC

Reverse complement sequence

GGGGAAGATGAGGTATGATAGGTGGGTCTCATCATTGTTTTTTTTTAAAAAAAGTGCTGACTGGATTTCACGCGTATGCCACTTAGGATAAACCAGGGTA[A/G]
TTTGTCATGCATTATAAGTTCAAGGTGAACAATGTTTGGTTTTCGGGTTAGGGGGTAATTTGATCGACCACAATAGCTCAGGGGTAATTTGATCGACCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.90%	7.80%	0.89%	47.36%	NA
All Indica	2759	19.20%	10.50%	1.30%	68.90%	NA
All Japonica	1512	92.10%	3.90%	0.07%	3.97%	NA
Aus	269	5.90%	0.70%	1.86%	91.45%	NA
Indica I	595	26.70%	19.20%	0.67%	53.45%	NA
Indica II	465	7.10%	24.10%	2.15%	66.67%	NA
Indica III	913	19.10%	0.10%	1.20%	79.63%	NA
Indica Intermediate	786	21.00%	8.10%	1.40%	69.47%	NA
Temperate Japonica	767	91.70%	2.30%	0.00%	6.00%	NA
Tropical Japonica	504	90.30%	7.30%	0.20%	2.18%	NA
Japonica Intermediate	241	97.10%	1.70%	0.00%	1.24%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	50.00%	16.70%	0.00%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119658949	T -> DEL	N	N	silent_mutation	Average:36.452; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1119658949	T -> C	LOC_Os11g33240.1	downstream_gene_variant ; 2969.0bp to feature; MODIFIER	silent_mutation	Average:36.452; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1119658949	T -> C	LOC_Os11g33250.1	downstream_gene_variant ; 141.0bp to feature; MODIFIER	silent_mutation	Average:36.452; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1119658949	T -> C	LOC_Os11g33260.1	downstream_gene_variant ; 1079.0bp to feature; MODIFIER	silent_mutation	Average:36.452; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1119658949	T -> C	LOC_Os11g33240.2	downstream_gene_variant ; 2969.0bp to feature; MODIFIER	silent_mutation	Average:36.452; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1119658949	T -> C	LOC_Os11g33240.3	downstream_gene_variant ; 2969.0bp to feature; MODIFIER	silent_mutation	Average:36.452; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1119658949	T -> C	LOC_Os11g33250-LOC_Os11g33260	intergenic_region ; MODIFIER	silent_mutation	Average:36.452; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119658949	3.02E-06	NA	mr1761	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119658949	NA	5.41E-06	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251