Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119579044:

Variant ID: vg1119579044 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 19579044
Reference Allele: T	Alternative Allele: C,TGGAGGTTTGGACAGAGATGGGAGGAGATAGGGGCCTCATCAGTCGCGTGGCC
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCACATCTCCACCACCGGTCAGGCTCGATGGTGTAGCCGCCACCGCCACCCAACTCCTCTTCGTTGGTCGCCTCCCTTCTCCTCATCAGTCGCGTGGC[T/C,TGGAGGTTTGGACAGAGATGGGAGGAGATAGGGGCCTCATCAGTCGCGTGGCC]
TGGAGGTTTGGACAGAGATGGGAGGAGATAGGGGGAGAGAGGGAAGAAGACTTGTTTCACTGATATGTGGGATCTACATACCTTTTTACTTTATGTTTTT

Reverse complement sequence

AAAAACATAAAGTAAAAAGGTATGTAGATCCCACATATCAGTGAAACAAGTCTTCTTCCCTCTCTCCCCCTATCTCCTCCCATCTCTGTCCAAACCTCCA[A/G,GGCCACGCGACTGATGAGGCCCCTATCTCCTCCCATCTCTGTCCAAACCTCCA]
GCCACGCGACTGATGAGGAGAAGGGAGGCGACCAACGAAGAGGAGTTGGGTGGCGGTGGCGGCTACACCATCGAGCCTGACCGGTGGTGGAGATGTGGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.40%	29.40%	0.13%	0.00%	TGGAGGTTTGGACAGAGATGGGAGGAGATAGGGGCCTCATCAGTCGCGTGGCC: 0.02%
All Indica	2759	85.70%	14.10%	0.18%	0.00%	TGGAGGTTTGGACAGAGATGGGAGGAGATAGGGGCCTCATCAGTCGCGTGGCC: 0.04%
All Japonica	1512	40.40%	59.60%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	76.30%	23.40%	0.34%	0.00%	NA
Indica II	465	95.50%	4.50%	0.00%	0.00%	NA
Indica III	913	87.60%	12.20%	0.22%	0.00%	NA
Indica Intermediate	786	84.70%	15.00%	0.13%	0.00%	TGGAGGTTTGGACAGAGATGGGAGGAGATAGGGGCCTCATCAGTCGCGTGGCC: 0.13%
Temperate Japonica	767	14.60%	85.40%	0.00%	0.00%	NA
Tropical Japonica	504	76.20%	23.80%	0.00%	0.00%	NA
Japonica Intermediate	241	47.70%	52.30%	0.00%	0.00%	NA
VI/Aromatic	96	27.10%	72.90%	0.00%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119579044	T -> TGGAGGTTTGGACAGAGATGGGAGGAGATA GGGGCCTCATCAGTCGCGTGGCC	LOC_Os11g33090.1	upstream_gene_variant ; 2506.0bp to feature; MODIFIER	silent_mutation	Average:82.38; most accessible tissue: Callus, score: 91.085	N	N	N	N
vg1119579044	T -> TGGAGGTTTGGACAGAGATGGGAGGAGATA GGGGCCTCATCAGTCGCGTGGCC	LOC_Os11g33100.1	upstream_gene_variant ; 1261.0bp to feature; MODIFIER	silent_mutation	Average:82.38; most accessible tissue: Callus, score: 91.085	N	N	N	N
vg1119579044	T -> TGGAGGTTTGGACAGAGATGGGAGGAGATA GGGGCCTCATCAGTCGCGTGGCC	LOC_Os11g33090-LOC_Os11g33100	intergenic_region ; MODIFIER	silent_mutation	Average:82.38; most accessible tissue: Callus, score: 91.085	N	N	N	N
vg1119579044	T -> C	LOC_Os11g33090.1	upstream_gene_variant ; 2505.0bp to feature; MODIFIER	silent_mutation	Average:82.38; most accessible tissue: Callus, score: 91.085	N	N	N	N
vg1119579044	T -> C	LOC_Os11g33100.1	upstream_gene_variant ; 1262.0bp to feature; MODIFIER	silent_mutation	Average:82.38; most accessible tissue: Callus, score: 91.085	N	N	N	N
vg1119579044	T -> C	LOC_Os11g33090-LOC_Os11g33100	intergenic_region ; MODIFIER	silent_mutation	Average:82.38; most accessible tissue: Callus, score: 91.085	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1119579044	T	C	0.01	0.01	0.0	0.0	0.01	0.01
vg1119579044	T	TGGAG*	-0.03	0.04	0.03	-0.01	0.0	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119579044	4.17E-06	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579044	6.15E-06	NA	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579044	NA	7.51E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579044	NA	8.93E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579044	NA	9.47E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579044	NA	6.70E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579044	NA	4.29E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579044	NA	1.39E-17	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579044	NA	4.50E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579044	NA	1.28E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119579044	2.20E-06	2.20E-06	mr1666_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251