Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119545646:

Variant ID: vg1119545646 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19545646
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCCCTTCAAGACCTCAAACAAAGGCTGGCACGCCAACTGGTTCTATGTTCAAAATCCTAAACCAGCCCTTCCCGAGTACTCTTGTCTCCCTCCAGTCT[A/G]
CCAAGATACATGGAATTCATTGCCTACAGGAGATGAGGCAGCCCAGGCTGTAGAACTAATGGAGCGCATGATAAAGCTGAAAGAGCAAGGTTTGCAGGGA

Reverse complement sequence

TCCCTGCAAACCTTGCTCTTTCAGCTTTATCATGCGCTCCATTAGTTCTACAGCCTGGGCTGCCTCATCTCCTGTAGGCAATGAATTCCATGTATCTTGG[T/C]
AGACTGGAGGGAGACAAGAGTACTCGGGAAGGGCTGGTTTAGGATTTTGAACATAGAACCAGTTGGCGTGCCAGCCTTTGTTTGAGGTCTTGAAGGGCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.00%	1.70%	0.32%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.07%	0.00%	NA
All Japonica	1512	93.90%	5.20%	0.86%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	97.00%	2.10%	0.91%	0.00%	NA
Tropical Japonica	504	93.10%	6.70%	0.20%	0.00%	NA
Japonica Intermediate	241	85.90%	12.00%	2.07%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119545646	A -> G	LOC_Os11g33060.1	missense_variant ; p.Tyr116Cys; MODERATE	nonsynonymous_codon ; Y116C	Average:28.029; most accessible tissue: Zhenshan97 flower, score: 40.565	probably damaging	3.107	DELETERIOUS	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119545646	3.69E-06	NA	mr1062	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	NA	3.11E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	NA	8.19E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	5.25E-07	NA	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	2.36E-06	3.40E-07	mr1720	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	6.07E-06	NA	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	1.42E-08	1.04E-09	mr1113_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	NA	1.29E-07	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	NA	1.39E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	NA	2.01E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	NA	2.64E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	NA	5.25E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119545646	6.95E-06	4.26E-09	mr1750_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251