Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119398753:

Variant ID: vg1119398753 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 19398753
Reference Allele: C	Alternative Allele: T,CGGT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCATTTGAGCACTGACATTTTGAGAGAGTGGAAAATAGTAAATTCCCCCGGCAGTATGTAGATGCTAGAAACGAGAGGGCTCACCGAGTTAGCTTAAAA[C/T,CGGT]
GGCGAGATGCGGCCGGAAAAACTTCACGGCGGCAGAAACAGGGCACGGCGGTGGCGGCGGAGCTCGGTCGAACGCAGCAAGGTGAAAGTCATCGCAGAGC

Reverse complement sequence

GCTCTGCGATGACTTTCACCTTGCTGCGTTCGACCGAGCTCCGCCGCCACCGCCGTGCCCTGTTTCTGCCGCCGTGAAGTTTTTCCGGCCGCATCTCGCC[G/A,ACCG]
TTTTAAGCTAACTCGGTGAGCCCTCTCGTTTCTAGCATCTACATACTGCCGGGGGAATTTACTATTTTCCACTCTCTCAAAATGTCAGTGCTCAAATGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.50%	3.90%	3.77%	51.54%	CGGT: 0.32%
All Indica	2759	11.00%	6.30%	5.94%	76.40%	CGGT: 0.36%
All Japonica	1512	93.10%	0.10%	0.40%	6.35%	CGGT: 0.07%
Aus	269	27.90%	3.30%	1.86%	66.54%	CGGT: 0.37%
Indica I	595	4.70%	0.50%	2.02%	92.77%	NA
Indica II	465	19.10%	7.50%	3.44%	69.89%	NA
Indica III	913	7.70%	11.00%	10.19%	71.08%	CGGT: 0.11%
Indica Intermediate	786	14.80%	4.60%	5.47%	74.05%	CGGT: 1.15%
Temperate Japonica	767	96.50%	0.30%	0.26%	3.00%	NA
Tropical Japonica	504	89.70%	0.00%	0.20%	10.12%	NA
Japonica Intermediate	241	89.20%	0.00%	1.24%	9.13%	CGGT: 0.41%
VI/Aromatic	96	91.70%	0.00%	2.08%	3.12%	CGGT: 3.12%
Intermediate	90	43.30%	0.00%	1.11%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119398753	C -> CGGT	LOC_Os11g32840.1	upstream_gene_variant ; 4637.0bp to feature; MODIFIER	silent_mutation	Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1119398753	C -> CGGT	LOC_Os11g32830.1	downstream_gene_variant ; 4051.0bp to feature; MODIFIER	silent_mutation	Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1119398753	C -> CGGT	LOC_Os11g32830-LOC_Os11g32840	intergenic_region ; MODIFIER	silent_mutation	Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1119398753	C -> T	LOC_Os11g32840.1	upstream_gene_variant ; 4638.0bp to feature; MODIFIER	silent_mutation	Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1119398753	C -> T	LOC_Os11g32830.1	downstream_gene_variant ; 4050.0bp to feature; MODIFIER	silent_mutation	Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1119398753	C -> T	LOC_Os11g32830-LOC_Os11g32840	intergenic_region ; MODIFIER	silent_mutation	Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1119398753	C -> DEL	N	N	silent_mutation	Average:32.61; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119398753	NA	3.07E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753	4.99E-06	5.85E-07	mr1227_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753	NA	2.39E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753	NA	1.90E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753	NA	7.00E-09	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753	NA	2.74E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753	NA	5.58E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119398753	NA	5.34E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251