| Variant ID: vg1119374158 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 19374158 |
| Reference Allele: C | Alternative Allele: A,T,CAAATAT |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCGGCCCAAGCAATCACACATTGCCCTGAAAGCCTAGCCTAGCAGAGGGACCTGTTATGAAACTATTATCTCCTGCTAGAGATAAATATGGGGTCATAC[C/A,T,CAAATAT]
AAATATATGGAAACGTATCATAAAAGGACTCTTCCTATTATGGGTATATATACTGAGAGAGAGGGCTTGAGAGGTTGGTTGATGTATCCGCATAAGGTTA
TAACCTTATGCGGATACATCAACCAACCTCTCAAGCCCTCTCTCTCAGTATATATACCCATAATAGGAAGAGTCCTTTTATGATACGTTTCCATATATTT[G/T,A,ATATTTG]
GTATGACCCCATATTTATCTCTAGCAGGAGATAATAGTTTCATAACAGGTCCCTCTGCTAGGCTAGGCTTTCAGGGCAATGTGTGATTGCTTGGGCCGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 1.70% | 0.93% | 2.79% | T: 0.06%; CAAATAT: 0.02% |
| All Indica | 2759 | 92.90% | 2.80% | 1.09% | 3.19% | CAAATAT: 0.04% |
| All Japonica | 1512 | 98.60% | 0.00% | 0.07% | 1.26% | T: 0.07% |
| Aus | 269 | 86.20% | 0.00% | 4.46% | 9.29% | NA |
| Indica I | 595 | 97.60% | 0.20% | 0.84% | 1.34% | NA |
| Indica II | 465 | 78.30% | 12.00% | 2.80% | 6.88% | NA |
| Indica III | 913 | 99.00% | 0.00% | 0.00% | 0.88% | CAAATAT: 0.11% |
| Indica Intermediate | 786 | 90.80% | 2.50% | 1.53% | 5.09% | NA |
| Temperate Japonica | 767 | 97.50% | 0.00% | 0.00% | 2.48% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.20% | 0.00% | T: 0.20% |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 2.20% | 1.11% | 0.00% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119374158 | C -> T | LOC_Os11g32790.1 | upstream_gene_variant ; 3546.0bp to feature; MODIFIER | silent_mutation | Average:40.965; most accessible tissue: Zhenshan97 flower, score: 83.392 | N | N | N | N |
| vg1119374158 | C -> T | LOC_Os11g32800.1 | downstream_gene_variant ; 1330.0bp to feature; MODIFIER | silent_mutation | Average:40.965; most accessible tissue: Zhenshan97 flower, score: 83.392 | N | N | N | N |
| vg1119374158 | C -> T | LOC_Os11g32790-LOC_Os11g32800 | intergenic_region ; MODIFIER | silent_mutation | Average:40.965; most accessible tissue: Zhenshan97 flower, score: 83.392 | N | N | N | N |
| vg1119374158 | C -> CAAATAT | LOC_Os11g32790.1 | upstream_gene_variant ; 3547.0bp to feature; MODIFIER | silent_mutation | Average:40.965; most accessible tissue: Zhenshan97 flower, score: 83.392 | N | N | N | N |
| vg1119374158 | C -> CAAATAT | LOC_Os11g32800.1 | downstream_gene_variant ; 1329.0bp to feature; MODIFIER | silent_mutation | Average:40.965; most accessible tissue: Zhenshan97 flower, score: 83.392 | N | N | N | N |
| vg1119374158 | C -> CAAATAT | LOC_Os11g32790-LOC_Os11g32800 | intergenic_region ; MODIFIER | silent_mutation | Average:40.965; most accessible tissue: Zhenshan97 flower, score: 83.392 | N | N | N | N |
| vg1119374158 | C -> A | LOC_Os11g32790.1 | upstream_gene_variant ; 3546.0bp to feature; MODIFIER | silent_mutation | Average:40.965; most accessible tissue: Zhenshan97 flower, score: 83.392 | N | N | N | N |
| vg1119374158 | C -> A | LOC_Os11g32800.1 | downstream_gene_variant ; 1330.0bp to feature; MODIFIER | silent_mutation | Average:40.965; most accessible tissue: Zhenshan97 flower, score: 83.392 | N | N | N | N |
| vg1119374158 | C -> A | LOC_Os11g32790-LOC_Os11g32800 | intergenic_region ; MODIFIER | silent_mutation | Average:40.965; most accessible tissue: Zhenshan97 flower, score: 83.392 | N | N | N | N |
| vg1119374158 | C -> DEL | N | N | silent_mutation | Average:40.965; most accessible tissue: Zhenshan97 flower, score: 83.392 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119374158 | 8.36E-06 | 9.57E-07 | mr1432 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119374158 | NA | 3.15E-06 | mr1537 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119374158 | NA | 8.43E-06 | mr1645 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119374158 | NA | 3.23E-06 | mr1647 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119374158 | NA | 1.88E-07 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119374158 | NA | 1.75E-06 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119374158 | NA | 5.96E-06 | mr1956 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |