Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119033238:

Variant ID: vg1119033238 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19033238
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AACGGTCAAACATTTTTAAAAAAGTTAACGGCGTCCAACATTTTAGAACGGAGAAGTACCAAATACTGCTTACTACTTGTACAGCCGTCCCCGCAGTCCG[C/G]
TCGCTTGTACTACAGTCTACAGTCGGTGCCGCTCGGTTCTAGAACAGCTACTGCGGCCGCTGCCACAGGTTCAACTTGAAATCAGCAGATCAAGAGCCTG

Reverse complement sequence

CAGGCTCTTGATCTGCTGATTTCAAGTTGAACCTGTGGCAGCGGCCGCAGTAGCTGTTCTAGAACCGAGCGGCACCGACTGTAGACTGTAGTACAAGCGA[G/C]
CGGACTGCGGGGACGGCTGTACAAGTAGTAAGCAGTATTTGGTACTTCTCCGTTCTAAAATGTTGGACGCCGTTAACTTTTTTAAAAATGTTTGACCGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 46.20% 0.40% 0.00% NA
All Indica  2759 24.10% 75.70% 0.14% 0.00% NA
All Japonica  1512 97.40% 1.80% 0.79% 0.00% NA
Aus  269 87.70% 12.30% 0.00% 0.00% NA
Indica I  595 9.70% 89.70% 0.50% 0.00% NA
Indica II  465 34.60% 65.40% 0.00% 0.00% NA
Indica III  913 23.30% 76.70% 0.00% 0.00% NA
Indica Intermediate  786 29.80% 70.10% 0.13% 0.00% NA
Temperate Japonica  767 98.00% 1.30% 0.65% 0.00% NA
Tropical Japonica  504 96.60% 2.40% 0.99% 0.00% NA
Japonica Intermediate  241 97.10% 2.10% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 62.20% 35.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119033238 C -> G LOC_Os11g32210.1 upstream_gene_variant ; 3848.0bp to feature; MODIFIER silent_mutation Average:70.709; most accessible tissue: Callus, score: 90.265 N N N N
vg1119033238 C -> G LOC_Os11g32220.1 downstream_gene_variant ; 2973.0bp to feature; MODIFIER silent_mutation Average:70.709; most accessible tissue: Callus, score: 90.265 N N N N
vg1119033238 C -> G LOC_Os11g32210-LOC_Os11g32220 intergenic_region ; MODIFIER silent_mutation Average:70.709; most accessible tissue: Callus, score: 90.265 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1119033238 C G 0.0 0.0 0.0 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119033238 NA 1.15E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119033238 NA 5.33E-08 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119033238 NA 3.90E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119033238 NA 5.62E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119033238 NA 1.20E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119033238 NA 2.96E-06 mr1633 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119033238 NA 9.94E-10 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119033238 NA 7.53E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119033238 NA 1.37E-06 mr1837 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119033238 NA 2.53E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251