Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118328578:

Variant ID: vg1118328578 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18328578
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAGGATGACATGGCACGCCCTAGAAATTATTCTTTTCCGTAGAAGTTTATCACGGTTGAATCATTAAGTTTTTTAAAGACACCATGGATCTAAATTTG[G/A]
ATGTGTTCGCAAATTTGATGATTATTTAGGGTGCTTGTTGTTTAGCCAGTAAAAGATAAATCTCGTAGAGCTTTGCAAGATGAAAACGCGTGCACACCCT

Reverse complement sequence

AGGGTGTGCACGCGTTTTCATCTTGCAAAGCTCTACGAGATTTATCTTTTACTGGCTAAACAACAAGCACCCTAAATAATCATCAAATTTGCGAACACAT[C/T]
CAAATTTAGATCCATGGTGTCTTTAAAAAACTTAATGATTCAACCGTGATAAACTTCTACGGAAAAGAATAATTTCTAGGGCGTGCCATGTCATCCTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 6.40% 0.85% 0.72% NA
All Indica  2759 88.40% 10.40% 1.27% 0.00% NA
All Japonica  1512 98.30% 0.30% 0.13% 1.26% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 98.80% 0.20% 1.01% 0.00% NA
Indica II  465 83.00% 15.90% 1.08% 0.00% NA
Indica III  913 84.70% 13.60% 1.75% 0.00% NA
Indica Intermediate  786 87.90% 11.10% 1.02% 0.00% NA
Temperate Japonica  767 97.50% 0.00% 0.13% 2.35% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 81.20% 2.10% 3.12% 13.54% NA
Intermediate  90 90.00% 8.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118328578 G -> A LOC_Os11g31410.1 downstream_gene_variant ; 1545.0bp to feature; MODIFIER silent_mutation Average:24.122; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N
vg1118328578 G -> A LOC_Os11g31400-LOC_Os11g31410 intergenic_region ; MODIFIER silent_mutation Average:24.122; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N
vg1118328578 G -> DEL N N silent_mutation Average:24.122; most accessible tissue: Minghui63 flag leaf, score: 35.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118328578 NA 3.23E-06 mr1035 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 9.33E-06 9.33E-06 mr1046 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 5.12E-06 5.12E-06 mr1048 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 8.77E-06 mr1049 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 3.42E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 1.85E-06 1.85E-06 mr1058 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 4.07E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 8.27E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 2.63E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 9.08E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 4.01E-06 4.01E-06 mr1205 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 5.08E-06 mr1209 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 8.04E-06 mr1228 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 1.86E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 1.48E-07 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 9.84E-06 mr1304 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 1.75E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 1.05E-06 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 4.68E-07 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 7.67E-07 7.67E-07 mr1465 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 2.95E-06 mr1552 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 9.25E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 7.11E-06 7.10E-06 mr1724 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 3.27E-06 mr1820 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 8.96E-06 mr1825 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 9.94E-10 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 3.83E-09 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 1.83E-11 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 4.85E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 5.58E-07 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 9.02E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 5.45E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 3.75E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118328578 NA 5.57E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251