Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117431373:

Variant ID: vg1117431373 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17431373
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCAAAAATTTCAGTATATCGGCACCCTGATACAAAAGCCGAAAATGGAAGAATGAACCTGGCCACCACGCCTCTTCTCTTTCCCAGAGCTCCAACCCC[C/T]
TGCAACGTTATTGTTCCGCCCCGCCGGCCTCAAATTCAACAGCGACGGAGACGGCTCAGATCGATGCGCGGGGATGCGCTGGCGACTCGAAGCCAACTGA

Reverse complement sequence

TCAGTTGGCTTCGAGTCGCCAGCGCATCCCCGCGCATCGATCTGAGCCGTCTCCGTCGCTGTTGAATTTGAGGCCGGCGGGGCGGAACAATAACGTTGCA[G/A]
GGGGTTGGAGCTCTGGGAAAGAGAAGAGGCGTGGTGGCCAGGTTCATTCTTCCATTTTCGGCTTTTGTATCAGGGTGCCGATATACTGAAATTTTTGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 2.30% 0.28% 3.91% NA
All Indica  2759 89.50% 3.70% 0.36% 6.52% NA
All Japonica  1512 99.70% 0.10% 0.07% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 84.30% 5.60% 1.08% 9.03% NA
Indica III  913 86.00% 4.20% 0.11% 9.75% NA
Indica Intermediate  786 88.80% 4.50% 0.51% 6.23% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 6.70% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117431373 C -> T LOC_Os11g29980.1 upstream_gene_variant ; 2366.0bp to feature; MODIFIER silent_mutation Average:85.133; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N
vg1117431373 C -> T LOC_Os11g29990.1 downstream_gene_variant ; 2885.0bp to feature; MODIFIER silent_mutation Average:85.133; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N
vg1117431373 C -> T LOC_Os11g29980-LOC_Os11g29990 intergenic_region ; MODIFIER silent_mutation Average:85.133; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N
vg1117431373 C -> DEL N N silent_mutation Average:85.133; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117431373 C T -0.01 0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117431373 2.50E-06 2.50E-06 mr1046 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 2.07E-06 2.07E-06 mr1048 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 1.42E-06 mr1049 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 5.83E-06 1.73E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 1.27E-06 1.27E-06 mr1058 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 3.95E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 5.60E-06 6.60E-07 mr1147 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 8.22E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 4.80E-06 4.80E-06 mr1205 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 7.08E-06 mr1209 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 4.67E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 1.67E-06 1.67E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 4.61E-07 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 7.39E-06 7.39E-06 mr1353 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 8.68E-06 3.72E-07 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 4.37E-06 4.15E-06 mr1382 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 9.64E-06 2.18E-07 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 8.65E-07 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 5.74E-06 5.74E-06 mr1440 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 5.47E-08 5.47E-08 mr1465 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 4.99E-06 4.99E-06 mr1512 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 4.88E-06 4.88E-06 mr1516 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 2.03E-06 mr1552 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 5.46E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 8.47E-06 NA mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 9.72E-06 mr1820 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 3.83E-09 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 6.40E-06 2.35E-08 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 1.56E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 NA 3.69E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117431373 1.82E-06 1.82E-06 mr1972 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251