Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117255997:

Variant ID: vg1117255997 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17255997
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCCTTGTCCCTTATATAGGGGTTGATCTTGCCATCTACAGGCCCTCCTCTACATCTAACTCGGGATAGAAACAAAAGGAAACCCGAAACATGTCTTCC[C/T]
AAGCAAGGAAAACTCGAAACCCGACAAAACAGACTCGGACACGGACTCTGCCAGTCAGACCGGCCACACACTGCCGGTCTAACCGGCCTACTGGCGGTGG

Reverse complement sequence

CCACCGCCAGTAGGCCGGTTAGACCGGCAGTGTGTGGCCGGTCTGACTGGCAGAGTCCGTGTCCGAGTCTGTTTTGTCGGGTTTCGAGTTTTCCTTGCTT[G/A]
GGAAGACATGTTTCGGGTTTCCTTTTGTTTCTATCCCGAGTTAGATGTAGAGGAGGGCCTGTAGATGGCAAGATCAACCCCTATATAAGGGACAAGGCCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.70%	25.50%	0.68%	46.13%	NA
All Indica	2759	39.10%	10.00%	0.58%	50.34%	NA
All Japonica	1512	11.80%	45.30%	0.93%	41.93%	NA
Aus	269	3.70%	83.30%	0.37%	12.64%	NA
Indica I	595	31.60%	4.40%	0.50%	63.53%	NA
Indica II	465	35.10%	16.60%	0.65%	47.74%	NA
Indica III	913	46.70%	6.60%	0.11%	46.66%	NA
Indica Intermediate	786	38.30%	14.40%	1.15%	46.18%	NA
Temperate Japonica	767	1.80%	83.30%	0.13%	14.73%	NA
Tropical Japonica	504	28.00%	2.20%	1.39%	68.45%	NA
Japonica Intermediate	241	10.00%	14.50%	2.49%	73.03%	NA
VI/Aromatic	96	3.10%	5.20%	1.04%	90.62%	NA
Intermediate	90	41.10%	18.90%	0.00%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117255997	C -> T	LOC_Os11g29740.1	upstream_gene_variant ; 3409.0bp to feature; MODIFIER	silent_mutation	Average:28.73; most accessible tissue: Callus, score: 56.722	N	N	N	N
vg1117255997	C -> T	LOC_Os11g29750.1	upstream_gene_variant ; 3930.0bp to feature; MODIFIER	silent_mutation	Average:28.73; most accessible tissue: Callus, score: 56.722	N	N	N	N
vg1117255997	C -> T	LOC_Os11g29740-LOC_Os11g29750	intergenic_region ; MODIFIER	silent_mutation	Average:28.73; most accessible tissue: Callus, score: 56.722	N	N	N	N
vg1117255997	C -> DEL	N	N	silent_mutation	Average:28.73; most accessible tissue: Callus, score: 56.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117255997	NA	6.65E-07	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	3.36E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	2.01E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	1.79E-06	8.59E-10	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	2.41E-06	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	1.38E-09	mr1561	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	6.81E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	7.36E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	4.90E-08	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	5.66E-09	mr1908	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	9.48E-06	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	1.04E-07	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117255997	NA	4.77E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251