Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117244183:

Variant ID: vg1117244183 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 17244183
Reference Allele: G	Alternative Allele: C,GT,GTGT
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAGAAATAAGAAGAGGATTACCGACACACTCTACTCTCTCCCTAATTCTAGTATACAATAAAATACAATAGAGCCTCTTATAATTCAGTTCAAGCTTT[G/C,GT,GTGT]
GTGTGTGTGTGTGAGAGAGAGAGAATGAGAGATGAGAGGGGTATTGATAGGTGGAGAAGTGCCTTGGGAGTGTGGAGATGCTAAGCATCCAAACAACATC

Reverse complement sequence

GATGTTGTTTGGATGCTTAGCATCTCCACACTCCCAAGGCACTTCTCCACCTATCAATACCCCTCTCATCTCTCATTCTCTCTCTCTCACACACACACAC[C/G,AC,ACAC]
AAAGCTTGAACTGAATTATAAGAGGCTCTATTGTATTTTATTGTATACTAGAATTAGGGAGAGAGTAGAGTGTGTCGGTAATCCTCTTCTTATTTCTTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.30%	15.90%	0.78%	43.80%	GT: 1.14%; GTGT: 0.04%
All Indica	2759	51.00%	1.50%	0.47%	47.01%	NA
All Japonica	1512	8.30%	46.00%	1.39%	40.61%	GT: 3.51%; GTGT: 0.13%
Aus	269	84.80%	1.90%	0.37%	13.01%	NA
Indica I	595	36.80%	2.20%	0.67%	60.34%	NA
Indica II	465	51.60%	1.10%	0.65%	46.67%	NA
Indica III	913	58.90%	1.00%	0.00%	40.09%	NA
Indica Intermediate	786	52.30%	1.80%	0.76%	45.17%	NA
Temperate Japonica	767	2.00%	83.70%	0.52%	13.82%	NA
Tropical Japonica	504	17.90%	2.20%	2.38%	67.06%	GT: 10.12%; GTGT: 0.40%
Japonica Intermediate	241	8.70%	17.80%	2.07%	70.54%	GT: 0.83%
VI/Aromatic	96	7.30%	0.00%	1.04%	91.67%	NA
Intermediate	90	47.80%	10.00%	1.11%	40.00%	GT: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117244183	G -> DEL	N	N	silent_mutation	Average:35.522; most accessible tissue: Callus, score: 71.129	N	N	N	N
vg1117244183	G -> GT	LOC_Os11g29730.1	downstream_gene_variant ; 988.0bp to feature; MODIFIER	silent_mutation	Average:35.522; most accessible tissue: Callus, score: 71.129	N	N	N	N
vg1117244183	G -> GT	LOC_Os11g29720-LOC_Os11g29730	intergenic_region ; MODIFIER	silent_mutation	Average:35.522; most accessible tissue: Callus, score: 71.129	N	N	N	N
vg1117244183	G -> GTGT	LOC_Os11g29730.1	downstream_gene_variant ; 988.0bp to feature; MODIFIER	silent_mutation	Average:35.522; most accessible tissue: Callus, score: 71.129	N	N	N	N
vg1117244183	G -> GTGT	LOC_Os11g29720-LOC_Os11g29730	intergenic_region ; MODIFIER	silent_mutation	Average:35.522; most accessible tissue: Callus, score: 71.129	N	N	N	N
vg1117244183	G -> C	LOC_Os11g29730.1	downstream_gene_variant ; 989.0bp to feature; MODIFIER	silent_mutation	Average:35.522; most accessible tissue: Callus, score: 71.129	N	N	N	N
vg1117244183	G -> C	LOC_Os11g29720-LOC_Os11g29730	intergenic_region ; MODIFIER	silent_mutation	Average:35.522; most accessible tissue: Callus, score: 71.129	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117244183	3.70E-09	5.32E-15	mr1038	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117244183	9.36E-07	9.00E-07	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117244183	3.40E-11	6.19E-18	mr1389	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117244183	4.61E-08	6.56E-16	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117244183	1.37E-07	3.56E-15	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251