Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117164056:

Variant ID: vg1117164056 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17164056
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGTTATAACCTAAAGAACCATGTGCTTTCTTTTTATGTATTGTTATTTCTTCTTTATAGGCTTGTAGCTTTGCTTGTGTGCTTCGCATAGCTTTTGTC[G/A]
TTCCGGAGGTTCTCGAAGCGTGGGTCGCGGTCGTCGCCGAAGGTTCGGAAGGCCGTTATCTCTGAGCAAGGCAAGTCGCATCACCCTTGAGCATATTGAA

Reverse complement sequence

TTCAATATGCTCAAGGGTGATGCGACTTGCCTTGCTCAGAGATAACGGCCTTCCGAACCTTCGGCGACGACCGCGACCCACGCTTCGAGAACCTCCGGAA[C/T]
GACAAAAGCTATGCGAAGCACACAAGCAAAGCTACAAGCCTATAAAGAAGAAATAACAATACATAAAAAGAAAGCACATGGTTCTTTAGGTTATAACAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.80%	5.50%	0.44%	31.23%	NA
All Indica	2759	72.10%	5.40%	0.51%	21.96%	NA
All Japonica	1512	54.30%	6.50%	0.33%	38.82%	NA
Aus	269	34.20%	0.00%	0.37%	65.43%	NA
Indica I	595	82.00%	11.60%	0.67%	5.71%	NA
Indica II	465	58.50%	3.40%	0.86%	37.20%	NA
Indica III	913	72.90%	3.50%	0.00%	23.55%	NA
Indica Intermediate	786	71.60%	4.20%	0.76%	23.41%	NA
Temperate Japonica	767	87.20%	0.70%	0.26%	11.86%	NA
Tropical Japonica	504	18.80%	15.30%	0.20%	65.67%	NA
Japonica Intermediate	241	23.70%	7.10%	0.83%	68.46%	NA
VI/Aromatic	96	11.50%	0.00%	1.04%	87.50%	NA
Intermediate	90	62.20%	12.20%	0.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117164056	G -> A	LOC_Os11g29580.1	upstream_gene_variant ; 1064.0bp to feature; MODIFIER	silent_mutation	Average:33.631; most accessible tissue: Zhenshan97 flag leaf, score: 58.104	N	N	N	N
vg1117164056	G -> A	LOC_Os11g29600.1	downstream_gene_variant ; 4967.0bp to feature; MODIFIER	silent_mutation	Average:33.631; most accessible tissue: Zhenshan97 flag leaf, score: 58.104	N	N	N	N
vg1117164056	G -> A	LOC_Os11g29580-LOC_Os11g29600	intergenic_region ; MODIFIER	silent_mutation	Average:33.631; most accessible tissue: Zhenshan97 flag leaf, score: 58.104	N	N	N	N
vg1117164056	G -> DEL	N	N	silent_mutation	Average:33.631; most accessible tissue: Zhenshan97 flag leaf, score: 58.104	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117164056	NA	2.67E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117164056	NA	4.23E-06	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117164056	2.01E-06	1.32E-06	mr1457_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117164056	NA	4.44E-09	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117164056	NA	4.74E-06	mr1751_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117164056	NA	6.40E-06	mr1806_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117164056	NA	4.01E-06	mr1834_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117164056	NA	2.26E-07	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251