Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117142352:

Variant ID: vg1117142352 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17142352
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGCCTCTGAGGAACCTAAGGGAACTTTGGCTGGGGACGCCCAGAGCGGATAAGGCCTTGTCGGATCATGTAGAGACAAAAGACTATGTAAGATCTGGT[T/C]
GTGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATCGGAAACCGAGTTTTCCAACTTCACGGCTGGGGGCTAGGATCAGTGCTTGTTCAACCA

Reverse complement sequence

TGGTTGAACAAGCACTGATCCTAGCCCCCAGCCGTGAAGTTGGAAAACTCGGTTTCCGATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACAC[A/G]
ACCAGATCTTACATAGTCTTTTGTCTCTACATGATCCGACAAGGCCTTATCCGCTCTGGGCGTCCCCAGCCAAAGTTCCCTTAGGTTCCTCAGAGGCCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	20.00%	7.38%	24.29%	NA
All Indica	2759	71.30%	6.20%	5.33%	17.18%	NA
All Japonica	1512	13.00%	47.90%	3.17%	35.91%	NA
Aus	269	24.20%	11.50%	48.33%	15.99%	NA
Indica I	595	88.90%	4.40%	3.36%	3.36%	NA
Indica II	465	46.20%	15.90%	5.81%	32.04%	NA
Indica III	913	76.00%	0.40%	4.82%	18.73%	NA
Indica Intermediate	786	67.20%	8.70%	7.12%	17.05%	NA
Temperate Japonica	767	2.10%	85.50%	1.17%	11.21%	NA
Tropical Japonica	504	30.20%	5.20%	4.37%	60.32%	NA
Japonica Intermediate	241	11.60%	17.80%	7.05%	63.49%	NA
VI/Aromatic	96	7.30%	2.10%	17.71%	72.92%	NA
Intermediate	90	54.40%	17.80%	7.78%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117142352	T -> DEL	N	N	silent_mutation	Average:48.909; most accessible tissue: Zhenshan97 flag leaf, score: 75.455	N	N	N	N
vg1117142352	T -> C	LOC_Os11g29550.1	upstream_gene_variant ; 2816.0bp to feature; MODIFIER	silent_mutation	Average:48.909; most accessible tissue: Zhenshan97 flag leaf, score: 75.455	N	N	N	N
vg1117142352	T -> C	LOC_Os11g29530.1	downstream_gene_variant ; 478.0bp to feature; MODIFIER	silent_mutation	Average:48.909; most accessible tissue: Zhenshan97 flag leaf, score: 75.455	N	N	N	N
vg1117142352	T -> C	LOC_Os11g29540.1	downstream_gene_variant ; 625.0bp to feature; MODIFIER	silent_mutation	Average:48.909; most accessible tissue: Zhenshan97 flag leaf, score: 75.455	N	N	N	N
vg1117142352	T -> C	LOC_Os11g29530-LOC_Os11g29540	intergenic_region ; MODIFIER	silent_mutation	Average:48.909; most accessible tissue: Zhenshan97 flag leaf, score: 75.455	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117142352	NA	2.13E-06	mr1004	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117142352	NA	6.13E-10	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251