Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117141200:

Variant ID: vg1117141200 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17141200
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTTTTCGACAAGGGTTTTTCTGGCCGACCGCCCTTAAAGACGCTTGCGACATGGTTCAGCAGTGTGAAGCCTGTCAATTCCACAGTAAACACACGAAG[C/T]
TACCAGCACAAGCGCTCCAGACTATCCCTCTTACTTGGCCATTCTCGTGCTAGGGGCTCGACATACTTGGACCATTCCGACGAGGACAGGGCGGCTACAG

Reverse complement sequence

CTGTAGCCGCCCTGTCCTCGTCGGAATGGTCCAAGTATGTCGAGCCCCTAGCACGAGAATGGCCAAGTAAGAGGGATAGTCTGGAGCGCTTGTGCTGGTA[G/A]
CTTCGTGTGTTTACTGTGGAATTGACAGGCTTCACACTGCTGAACCATGTCGCAAGCGTCTTTAAGGGCGGTCGGCCAGAAAAACCCTTGTCGAAAAGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.40%	5.10%	1.71%	11.81%	NA
All Indica	2759	86.10%	4.70%	0.54%	8.63%	NA
All Japonica	1512	71.10%	6.50%	3.77%	18.65%	NA
Aus	269	87.70%	0.40%	2.23%	9.67%	NA
Indica I	595	86.40%	12.10%	0.00%	1.51%	NA
Indica II	465	85.20%	0.00%	0.65%	14.19%	NA
Indica III	913	85.20%	3.20%	0.66%	10.95%	NA
Indica Intermediate	786	87.40%	3.80%	0.76%	8.02%	NA
Temperate Japonica	767	92.40%	0.70%	0.39%	6.52%	NA
Tropical Japonica	504	52.00%	14.90%	6.15%	26.98%	NA
Japonica Intermediate	241	43.20%	7.50%	9.54%	39.83%	NA
VI/Aromatic	96	90.60%	0.00%	1.04%	8.33%	NA
Intermediate	90	81.10%	12.20%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117141200	C -> T	LOC_Os11g29550.1	upstream_gene_variant ; 3968.0bp to feature; MODIFIER	silent_mutation	Average:51.921; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1117141200	C -> T	LOC_Os11g29540.1	downstream_gene_variant ; 1777.0bp to feature; MODIFIER	silent_mutation	Average:51.921; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1117141200	C -> T	LOC_Os11g29530.1	intron_variant ; MODIFIER	silent_mutation	Average:51.921; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg1117141200	C -> DEL	N	N	silent_mutation	Average:51.921; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117141200	NA	7.44E-06	mr1564	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141200	5.66E-06	3.87E-07	mr1564	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141200	NA	8.09E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141200	NA	6.27E-06	mr1681_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141200	NA	7.90E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117141200	NA	7.10E-07	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251