Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117053183:

Variant ID: vg1117053183 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17053183
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATCCCTTGATATTAACATGGTAAAAATAAGTCAGCTACAGCAGCTACGGTAACACTAGCTCCCTAATTAACATATGTATATGTAAAACTATATGTATA[C/T]
ATAAAAGTATATTTATTTAATAATGAATCAAATGATAGGAAAATAATTAATAATTACTTAAATTTTTTGAATAAGACGAACGTCAGACATATTTAAAAAG

Reverse complement sequence

CTTTTTAAATATGTCTGACGTTCGTCTTATTCAAAAAATTTAAGTAATTATTAATTATTTTCCTATCATTTGATTCATTATTAAATAAATATACTTTTAT[G/A]
TATACATATAGTTTTACATATACATATGTTAATTAGGGAGCTAGTGTTACCGTAGCTGCTGTAGCTGACTTATTTTTACCATGTTAATATCAAGGGATTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.50%	14.20%	0.30%	0.00%	NA
All Indica	2759	76.00%	23.70%	0.29%	0.00%	NA
All Japonica	1512	99.50%	0.30%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	43.00%	56.50%	0.50%	0.00%	NA
Indica II	465	92.00%	8.00%	0.00%	0.00%	NA
Indica III	913	88.40%	11.50%	0.11%	0.00%	NA
Indica Intermediate	786	77.00%	22.50%	0.51%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	0.80%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	85.60%	10.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117053183	C -> T	LOC_Os11g29390.1	upstream_gene_variant ; 843.0bp to feature; MODIFIER	silent_mutation	Average:39.54; most accessible tissue: Callus, score: 76.061	N	N	N	N
vg1117053183	C -> T	LOC_Os11g29380.1	downstream_gene_variant ; 268.0bp to feature; MODIFIER	silent_mutation	Average:39.54; most accessible tissue: Callus, score: 76.061	N	N	N	N
vg1117053183	C -> T	LOC_Os11g29380-LOC_Os11g29390	intergenic_region ; MODIFIER	silent_mutation	Average:39.54; most accessible tissue: Callus, score: 76.061	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117053183	NA	3.91E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117053183	NA	1.18E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117053183	NA	8.18E-07	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117053183	NA	9.25E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117053183	NA	8.05E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117053183	NA	1.29E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117053183	3.67E-06	NA	mr1896	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117053183	4.22E-07	5.85E-11	mr1896	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117053183	NA	2.25E-09	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251