Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116955967:

Variant ID: vg1116955967 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16955967
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGATATAGTCTACGAAATACTAATTTGACCAACCATACATTTCTATCTCTACTATTATAAAAATTAAAGATGTTTTTACCGGTATTTTGGTACGTCATTC[A/G]
TGTTTGAATCGGTTTTAATTTTATGCTTCCATTTTAATCTATATCTCTACTTAAAAAAAGAAATTTCTGTCGTTGTAGAAAAGAAAGAAAAAGGTCTGAC

Reverse complement sequence

GTCAGACCTTTTTCTTTCTTTTCTACAACGACAGAAATTTCTTTTTTTAAGTAGAGATATAGATTAAAATGGAAGCATAAAATTAAAACCGATTCAAACA[T/C]
GAATGACGTACCAAAATACCGGTAAAAACATCTTTAATTTTTATAATAGTAGAGATAGAAATGTATGGTTGGTCAAATTAGTATTTCGTAGACTATATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	40.20%	0.40%	0.00%	NA
All Indica	2759	89.40%	10.00%	0.65%	0.00%	NA
All Japonica	1512	7.50%	92.50%	0.00%	0.00%	NA
Aus	269	63.90%	36.10%	0.00%	0.00%	NA
Indica I	595	87.60%	12.10%	0.34%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	87.30%	12.70%	0.00%	0.00%	NA
Indica Intermediate	786	87.80%	10.20%	2.04%	0.00%	NA
Temperate Japonica	767	3.40%	96.60%	0.00%	0.00%	NA
Tropical Japonica	504	11.50%	88.50%	0.00%	0.00%	NA
Japonica Intermediate	241	12.00%	88.00%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	54.40%	44.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116955967	A -> G	LOC_Os11g29240.1	upstream_gene_variant ; 2128.0bp to feature; MODIFIER	silent_mutation	Average:80.33; most accessible tissue: Callus, score: 91.785	N	N	N	N
vg1116955967	A -> G	LOC_Os11g29250.1	downstream_gene_variant ; 1676.0bp to feature; MODIFIER	silent_mutation	Average:80.33; most accessible tissue: Callus, score: 91.785	N	N	N	N
vg1116955967	A -> G	LOC_Os11g29240-LOC_Os11g29250	intergenic_region ; MODIFIER	silent_mutation	Average:80.33; most accessible tissue: Callus, score: 91.785	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116955967	NA	3.03E-06	mr1179	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116955967	NA	5.80E-14	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116955967	NA	6.87E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116955967	NA	6.87E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116955967	NA	4.35E-08	mr1624	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116955967	NA	1.65E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116955967	NA	3.55E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116955967	NA	3.10E-07	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116955967	NA	1.26E-07	mr1758_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251