Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116647697:

Variant ID: vg1116647697 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16647697
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTCCCTCTTGGGCCGCAGGCCGCAGCTGCCTCAACCCAACTCCCATCCCTCCCCATCAGTCCGTTTCAGGTCCTCCTCCCAGCCCAGCCATGGGTTGT[T/C]
GCCTTCCTCCAGCCGCCGCCTGTTCATCTCTCCCGGCTGAACCATAGCGCCGTCGCCTCGCCGATCTCCCTCCCCGCTCATTCCCTCCTCAAATTTAATC

Reverse complement sequence

GATTAAATTTGAGGAGGGAATGAGCGGGGAGGGAGATCGGCGAGGCGACGGCGCTATGGTTCAGCCGGGAGAGATGAACAGGCGGCGGCTGGAGGAAGGC[A/G]
ACAACCCATGGCTGGGCTGGGAGGAGGACCTGAAACGGACTGATGGGGAGGGATGGGAGTTGGGTTGAGGCAGCTGCGGCCTGCGGCCCAAGAGGGAGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	48.40%	0.91%	0.11%	NA
All Indica	2759	53.40%	45.60%	0.83%	0.14%	NA
All Japonica	1512	48.10%	50.90%	0.99%	0.00%	NA
Aus	269	18.60%	81.00%	0.37%	0.00%	NA
Indica I	595	78.00%	21.20%	0.67%	0.17%	NA
Indica II	465	46.50%	52.30%	1.08%	0.22%	NA
Indica III	913	41.90%	57.40%	0.55%	0.11%	NA
Indica Intermediate	786	52.30%	46.40%	1.15%	0.13%	NA
Temperate Japonica	767	83.30%	15.60%	1.04%	0.00%	NA
Tropical Japonica	504	7.90%	91.70%	0.40%	0.00%	NA
Japonica Intermediate	241	20.30%	77.60%	2.07%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	53.30%	41.10%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116647697	T -> DEL	N	N	silent_mutation	Average:62.064; most accessible tissue: Callus, score: 99.557	N	N	N	N
vg1116647697	T -> C	LOC_Os11g28750.1	upstream_gene_variant ; 784.0bp to feature; MODIFIER	silent_mutation	Average:62.064; most accessible tissue: Callus, score: 99.557	N	N	N	N
vg1116647697	T -> C	LOC_Os11g28740-LOC_Os11g28750	intergenic_region ; MODIFIER	silent_mutation	Average:62.064; most accessible tissue: Callus, score: 99.557	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116647697	NA	2.24E-10	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116647697	NA	4.35E-06	mr1157	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116647697	NA	7.51E-08	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116647697	NA	1.15E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116647697	NA	1.42E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116647697	NA	1.53E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116647697	NA	2.13E-07	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116647697	NA	5.83E-06	mr1621_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116647697	4.75E-06	4.75E-06	mr1693_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251