Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116643778:

Variant ID: vg1116643778 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16643778
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATCGAGCGGCAGCAGTGGTGGATCGATCATGCGGCGGCGGATCAAGCGGCGGAGGTGGCAGATCGAGGCGGCGACAGCAGATCGAGCCACGGCGGCGC[T/C]
GGGATCCATCTTCTTCCTCATCTACCTTTTCGGCTCCTCGCCATCTTCACACGGGAGGTAGTTGCAGCAACAGTGCGGGGCGAGGCATCTCCCCAACACG

Reverse complement sequence

CGTGTTGGGGAGATGCCTCGCCCCGCACTGTTGCTGCAACTACCTCCCGTGTGAAGATGGCGAGGAGCCGAAAAGGTAGATGAGGAAGAAGATGGATCCC[A/G]
GCGCCGCCGTGGCTCGATCTGCTGTCGCCGCCTCGATCTGCCACCTCCGCCGCTTGATCCGCCGCCGCATGATCGATCCACCACTGCTGCCGCTCGATTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.10%	33.90%	0.15%	0.85%	NA
All Indica	2759	98.00%	1.80%	0.14%	0.04%	NA
All Japonica	1512	6.70%	93.30%	0.07%	0.00%	NA
Aus	269	77.00%	9.30%	0.00%	13.75%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	98.90%	0.40%	0.65%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	94.90%	4.80%	0.13%	0.13%	NA
Temperate Japonica	767	3.90%	96.10%	0.00%	0.00%	NA
Tropical Japonica	504	11.50%	88.50%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.20%	0.41%	0.00%	NA
VI/Aromatic	96	6.20%	92.70%	1.04%	0.00%	NA
Intermediate	90	63.30%	33.30%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116643778	T -> DEL	N	N	silent_mutation	Average:67.034; most accessible tissue: Zhenshan97 young leaf, score: 88.759	N	N	N	N
vg1116643778	T -> C	LOC_Os11g28750.1	upstream_gene_variant ; 4703.0bp to feature; MODIFIER	silent_mutation	Average:67.034; most accessible tissue: Zhenshan97 young leaf, score: 88.759	N	N	N	N
vg1116643778	T -> C	LOC_Os11g28740.1	downstream_gene_variant ; 1831.0bp to feature; MODIFIER	silent_mutation	Average:67.034; most accessible tissue: Zhenshan97 young leaf, score: 88.759	N	N	N	N
vg1116643778	T -> C	LOC_Os11g28740-LOC_Os11g28750	intergenic_region ; MODIFIER	silent_mutation	Average:67.034; most accessible tissue: Zhenshan97 young leaf, score: 88.759	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116643778	NA	2.20E-75	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	NA	1.00E-11	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	NA	5.21E-83	mr1672	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	9.09E-06	4.57E-96	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	NA	5.75E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	NA	2.66E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	NA	2.66E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	NA	7.23E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	NA	1.29E-36	mr1541_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	6.01E-10	3.00E-135	mr1758_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	4.95E-09	4.13E-11	mr1758_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116643778	NA	1.32E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251